Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    Dedupe will merge assemblies, but it will not produce consensus sequences or join overlapping reads; it only removes sequences that are fully contained within other sequences (allowing the specified number of mismatches or edits).

    BBMap works pretty well for mapping Nanopore reads, but as GenoMax stated, it has a length cap of 6kbp. Reads longer than this will be broken into 6kbp pieces and mapped independently. The command I have been using for mapping Nanopore reads:

    mapPacBio.sh -Xmx20g k=7 in=reads.fastq ref=reference.fa maxlen=1000 minlen=200 idtag ow int=f qin=33 out=mapped1.sam minratio=0.15 ignorequality slow ordered maxindel1=40 maxindel2=400

    The "maxlen" flag shreds them to a max length of 1000; you can set that up to 6000. But I found 1000 gave a higher mapping rate.

    Comment

    • hubery_Bio
      Junior Member
      • Oct 2013
      • 5

      Hi, Brian,
      I used BBmap to evaluate the Insert Size of a PE dataset download from SRA database, and found that the peak of the histogram is 89 bp. Actually, the PE reads were 96-96 bp. It seems weird, since I saw it elsewhere that you defined the Insert Size as "PE reads + unsequenced part". In addition, the minimum Size was begin from 1 bp!
      Although the dataset has some problems in the quality, it is amazing to got this result.
      Could you help me? Sorry for my poor English...

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        It sounds like you don't have any "unsequenced part" in this library. If the insert size is shorter than read length, that means that the the library was fragmented into pieces that were too small, and the sequencer reads off the end of the genomic sequence into the adapter sequence. Before using those reads, you should do adapter trimming with (for example) BBDuk.

        As for the minimum size being 1bp, that is probably a read pair being mis-mapped. You can get a second opinion on the insert size distribution with BBMerge, which calculates it by looking for overlaps instead of by mapping, but I expect the result to be the same in this case. BBMap is more accurate for insert size calculations with long inserts (which don't overlap), while BBMerge is more accurate for insert sizes shorter than read length because the adapter sequence interferes with mapping.

        Comment

        • blsfoxfox
          Member
          • Jan 2013
          • 12

          Trimming of Nextera mate pair reads

          Hi Brian,

          I am using BBmap to trim the Nextera mate pair reads, could you please provide a workflow with parameters to show us how to do this with splitnextera.sh and bbduk.sh?

          Thanks in advance.

          Comment

          • Brian Bushnell
            Super Moderator
            • Jan 2014
            • 2709

            Sure. For simplicity, I will assume the reads are interleaved in a single file initially (you can transform between interleaved and dual-file reads with reformat.sh if you want). First thing is to trim the adapters with BBDuk:

            Code:
            bbduk.sh in=reads.fq out=trimmed.fq ktrim=r k=23 mink=12 hdist=1 tbo tpe ref=nextera_LMP_adapter.fa.gz
            nextera_LMP_adapter.fa.gz is in /bbmap/resources/.

            Next, if you want to remove contaminants/spikeins such as PhiX, you can do so now with a filtering pass of BBDuk, but that's optional.

            Finally, split the reads into LMP pairs, short pairs, and singletons:

            Code:
            splitnextera.sh in=trimmed.fq out=longmatepairs.fq outf=fragmentpairs.fq outu=unknownpairs.fq outs=singletons.fq mask=t
            At this point you could do quality-trimming if you want to on the individual sub-libraries; it's important not to do so sooner as it interferes with the ability to detect junctions. If all you care about is the LMP data you can just keep longmatepairs.fq and throw away the others, but theoretically, you might be able to get enough fragment pairs and singletons to assemble the contigs from those, then use the LMP for scaffolding, and thus get a complete single-library assembly. That's what Illumina is encouraging, at any rate.

            The majority of the reads in the "unknown" bin were LMP, not short-fragment reads, in the one library I tested (and also according to Illumina's data), but I would not really consider it safe to use for scaffolding OR contig-building, and would probably throw it away unless you don't have enough data.

            Comment

            • blsfoxfox
              Member
              • Jan 2013
              • 12

              Originally posted by Brian Bushnell View Post
              Sure. For simplicity, I will assume the reads are interleaved in a single file initially (you can transform between interleaved and dual-file reads with reformat.sh if you want). First thing is to trim the adapters with BBDuk:

              Code:
              bbduk.sh in=reads.fq out=trimmed.fq ktrim=r k=23 mink=12 hdist=1 tbo tpe ref=nextera_LMP_adapter.fa.gz
              nextera_LMP_adapter.fa.gz is in /bbmap/resources/.

              Next, if you want to remove contaminants/spikeins such as PhiX, you can do so now with a filtering pass of BBDuk, but that's optional.

              Finally, split the reads into LMP pairs, short pairs, and singletons:

              Code:
              splitnextera.sh in=trimmed.fq out=longmatepairs.fq outf=fragmentpairs.fq outu=unknownpairs.fq outs=singletons.fq mask=t
              At this point you could do quality-trimming if you want to on the individual sub-libraries; it's important not to do so sooner as it interferes with the ability to detect junctions. If all you care about is the LMP data you can just keep longmatepairs.fq and throw away the others, but theoretically, you might be able to get enough fragment pairs and singletons to assemble the contigs from those, then use the LMP for scaffolding, and thus get a complete single-library assembly. That's what Illumina is encouraging, at any rate.

              The majority of the reads in the "unknown" bin were LMP, not short-fragment reads, in the one library I tested (and also according to Illumina's data), but I would not really consider it safe to use for scaffolding OR contig-building, and would probably throw it away unless you don't have enough data.
              Hi Brian,

              Thank you for your patient instruction!
              I have three more question about the split step:
              1)After the split, what are the orientation of longmatepairs.fq and fragmentpairs.fq? I guess RF and FR respectively?
              2)What will be the insert size of those fragmentpairs.fq, 300bp?Does the original library size matter?
              3)I have tried another software called "Nxtrim" with similar function to seperate those Nextera Mate pairs into different groups, which gives me about 40% fragment pairs, do you think the number is reasonable? If you have used it, could you please tell me the difference between splitnextera.sh and Nxtrim for doing the same job?

              Thanks for your time in advance, I know that is too much to answer.

              Comment

              • Brian Bushnell
                Super Moderator
                • Jan 2014
                • 2709

                1) LMP maps as "outie", so the left read is reverse and the right read is forward. Fragment maps as "innie" like a normal fragment library, so left read forward and right read reverse.
                2) The insert size of the fragment pairs depends on your shearing length, while the insert size of the LMP pairs depends on something else, like the transposase concentration. In my data, frag peaked at 319bp and LMP peaked at 2605bp (see image).

                3) This was the output for one of our libraries:
                Code:
                Long Mate Pairs: 851440 reads (42.57%) 98864654 bases (32.74%)
                Fragment Pairs: 655758 reads (32.79%) 82605742 bases (27.35%)
                Unknown Pairs: 496638 reads (24.83%) 74992338 bases (24.83%)
                Singletons: 170008 reads (8.50%) 9856956 bases (3.26%)
                
                Adapters Detected: 751681 (75.17%)
                Bases Recovered: 266319690 (88.19%)
                I think 40% as fragment is reasonable; I assume the exact amount depends on reagent concentrations and times.

                I designed splitnextera.sh to recover more pairs as LMP and fewer as fragments, compared to NXTrim - you have some leeway in deciding which one you want to recover. In general, it should run faster, recover more reads as LMP, and generally recover a higher number of total reads and bases. But that's just based on my reading the NXTrim description; I have not actually tested them on the same dataset, so I'd be interested if you could give us some numbers.

                Incidentally, I'm considering upgrading it to increase the number of fragments and reduce the amount of unknown, but the difference would probably be slight since unknown is already mostly LMP.
                Attached Files
                Last edited by Brian Bushnell; 05-11-2015, 09:33 AM.

                Comment

                • blsfoxfox
                  Member
                  • Jan 2013
                  • 12

                  Originally posted by Brian Bushnell View Post
                  1) LMP maps as "outie", so the left read is reverse and the right read is forward. Fragment maps as "innie" like a normal fragment library, so left read forward and right read reverse.
                  2) The insert size of the fragment pairs depends on your shearing length, while the insert size of the LMP pairs depends on something else, like the transposase concentration. In my data, frag peaked at 319bp and LMP peaked at 2605bp (see image).

                  3) This was the output for one of our libraries:
                  Code:
                  Long Mate Pairs: 851440 reads (42.57%) 98864654 bases (32.74%)
                  Fragment Pairs: 655758 reads (32.79%) 82605742 bases (27.35%)
                  Unknown Pairs: 496638 reads (24.83%) 74992338 bases (24.83%)
                  Singletons: 170008 reads (8.50%) 9856956 bases (3.26%)
                  
                  Adapters Detected: 751681 (75.17%)
                  Bases Recovered: 266319690 (88.19%)
                  I think 40% as fragment is reasonable; I assume the exact amount depends on reagent concentrations and times.

                  I designed splitnextera.sh to recover more pairs as LMP and fewer as fragments, compared to NXTrim - you have some leeway in deciding which one you want to recover. In general, it should run faster, recover more reads as LMP, and generally recover a higher number of total reads and bases. But that's just based on my reading the NXTrim description; I have not actually tested them on the same dataset, so I'd be interested if you could give us some numbers.

                  Incidentally, I'm considering upgrading it to increase the number of fragments and reduce the amount of unknown, but the difference would probably be slight since unknown is already mostly LMP.
                  Your answer is always informative and helpful!

                  Thanks!

                  Comment

                  • Len Trigg
                    Registered Vendor
                    • Jun 2011
                    • 30

                    Hi Brian,

                    Could you please clarify the license for BBMap? I thought I might try a couple of runs with it for fun, but once I installed it I saw conflicting license information. In the top level of the tar file there is a license.txt that looks like a fairly permissive license (it doesn't look like one of the standard OSI open source licenses, but that's probably fine), yet within docs/readme.txt it explicitly states that the software is to be used for non-commercial use only.

                    Cheers,
                    Len.
                    Len Trigg, Ph.D.
                    Real Time Genomics
                    www.realtimegenomics.com

                    Comment

                    • Brian Bushnell
                      Super Moderator
                      • Jan 2014
                      • 2709

                      Hi Len,

                      To summarize, it appears that BBMap/BBTools is usable by any individual or organization, for any purpose (as long as the disclaimers are followed), without any need to recompense Berkeley Labs in any way. So a for-profit enterprise may run it without any restrictions.

                      The text about it being free for noncommercial use was added by me, to clarify, in case people were wondering, since initially it was made clear to me that that was the case by the legal department but I was not really sure what the status was with regards to commercial use (it was hard for me to get them to state things explicitly). Subsequently, however, BBMap was made part of Geneious, after they contacted Berkeley Lab and were told by the legal department that it's essentially an unrestricted license and commercial organizations do not need to pay anything. I should probably remove that line from the readme.

                      Comment

                      • Len Trigg
                        Registered Vendor
                        • Jun 2011
                        • 30

                        Brian,

                        Thanks for the reply, that clears things up nicely! (I agree with you about adjusting the readme.)

                        Cheers,
                        Len.
                        Len Trigg, Ph.D.
                        Real Time Genomics
                        www.realtimegenomics.com

                        Comment

                        • lankage
                          Member
                          • Oct 2014
                          • 20

                          bbmap settings

                          Hi Brian,
                          I was trying to use bbmap to remap some PacBio reads to some reference sequences in order to generate the detailed cigar string bbmap includes in SAM output. I am trying to generate mappings with sequences that are longer than a reference on one or more ends, but matching at 99% identity with the overlap portion. Previously i was using Geneious to do mappings and their tool seems to be doing the soft clipping i am looking for, but does not output the right type of cigar string. Could you help me with the specific settings to use with bbmap to include these mapping situations in the output?

                          Comment

                          • Brian Bushnell
                            Super Moderator
                            • Jan 2014
                            • 2709

                            For PacBio reads, you need to use mapPacBio.sh rather than BBMap.sh. It's the same algorithm, but with different parameters and support for longer reads.

                            mapPacBio.sh ref=reference.fasta in=reads.fasta out=mapped.sam idfilter=0.99 local

                            (if the reads are in fastq format, then also add the flag "maxlen=6000").

                            "idfilter=0.99" will limit the mappings to reads with 99% identity. The local flag will soft-clip the overhang bases before the idfilter is applied, so only the overlapping bases will be considered.

                            Comment

                            • lankage
                              Member
                              • Oct 2014
                              • 20

                              Hi Brian,
                              i took your advice with using the "local" parameter with mapPacBio.sh, but I am still seeing reads which perfectly map to a reference in the overlap and have ends that should be soft clipped be absent in the output file. Additionally, if i run mapPacBio.sh in isolation with just one read (fasta) and one reference (fasta), i get the expected output. The soft clipped perfect mappings seem to only get missed in the larger file.

                              output when running in isolation:
                              Code:
                              @HD     VN:1.4  SO:unsorted
                              @SQ     SN:16120_FcGR1_776delG_Ctg25    LN:894
                              @PG     ID:BBMap        PN:BBMap        VN:33.65        CL:java -Djava.library.path=/Users/mgraham/Desktop/PB6-FCGR/bbmap/jni/ -ea -Xmx10g BBMapPacBio build=1 overwrite=true minratio=0.40 fastareadlen=6000 ambiguous=best minscaf=100 startpad=10000 stoppad=10000 midpad=6000 ref=776delG.fasta in=lbc1_read.fasta out=test.sam outputunmapped=f idfilter=0.99 maxlen=6000 local -Xmx10g
                              lbc1_read_1165  0       16120_FcGR1_776delG_Ctg25       1       23      14S894=245S     *       0       0
                                     AGCTTGGAGACAACATGTGGTTCTTGACAGCTCTGCTCCTTTGGGTTCCAGTTGATGGGCAAGTGGATACCACAAAGGCAGTGATCACTTTGCAGCCTCCATGGGTCAGCGTGTTCCAAGAGGAAACTGTAACCTTACAGTGTGAGGTGCCCCGTCTGCCTGGGAGCAGCTCCACACAGTGGTTTCTCAATGGCACAGCCACTCAGACCTCGACTCCCAGCTACAGAATCACCTCTGCCAGTGTCAAGGACAGTGGTGAATACAGGTGCCAGAGAGGTCCCTCAGGGCGAAGTGACCCCATACAGCTGGAAATCCACAGAGACTGGCTACTACTGCAGGTATCCAGCAGAGTCTTCACAGAAGGAGAACCTCTGGCCTTGAGGTGTCATGCATGGAAGGATAAGCTGGTGTACAATGTGCTTTACTATCAAAATGGCAAAGCCTTTAAGTTTTTCTACCGGAATTCTCAACTCACCATTCTGAAAACCAACATAAGTCACAACGGCGCCTACCACTGCTCAGGCATGGGAAAGCATCGCTACACATCAGCAGGAGTATCTGTCACTGTGAAAGAGCTATTTCCAGCTCCAGTGCTGAATGCATCCGTGACATCCCCGCTCCTGGAGGGGAATCTGGTCACCCTGAGCTGTGAAACAAAGTTGCTTCTGCAGAGGCCTGGTTTGCAGCTTTACTTCTCCTTCTACATGGGCAGCAAGACCCTGCGAGGCAGGAACACGTCCTCTGAATACCAAATACTAACTGCTAGAAGAGAAGACTCTGGTTTTACTGGTGCGAGGCCACCACAGAAGACGGAAATGTCCTTAAGCGCAGCCCTGAGTTGGAGCTTCAAGTGCTTGGCCTCCAGTTACCAACTCCTGTCTGGCTTCATGTCCTTTTCTATCTGGTAGTGGGAATAATGTTTTTAGTGAACACTGTTCTCTGGGTGACAATACGTAAAGAACTGAAAAGAAAGAAAAAGTGGAATTTAGAAATCTCTTTGGATTCTGCTCATGAGAAGAAGGTAACTTCCAGCCTTCAAGAAGACAGACATTTAGAAGAAGAGCTGAAGAGTCAGGAACAAGAATAAAGAACAGCTGCAGGAAGGGGTGCACCGGAAGGAGCCTGAGGAGGCCAAGTAGCAGCAGCTCAGTGG       *       NM:i:0  AM:i:23
                              I can email a compressed set of files to demonstrate this if you'd be willing to take the time to look into it.
                              Last edited by Brian Bushnell; 05-15-2015, 01:06 PM.

                              Comment

                              • Brian Bushnell
                                Super Moderator
                                • Jan 2014
                                • 2709

                                Yes, please do email it, and I'll take a look.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  Today, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 11:10 AM
                                0 responses
                                8 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                30 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-09-2026, 10:04 AM
                                0 responses
                                38 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-08-2026, 10:08 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...