[GenoMax]

I wonder if viterbi program is having trouble with (NS500697:37:HH5V7BGXY:2:23303:13708:4313 1:N:0:TAAGGCGA+ATATAGAG ) the tag sequence which BBMap preserves but Bowtie does not.

Can you "reformat" the bbmap alignment using "trd=t" flag and see if that helps?

[jweger1988]

Hi Brian,

I'm having an issue I'm wondering you can help with.

I am using bbmap to align to a small viral genome. The resulting bam or sam file give me an error something like : Segmentation fault (core dumped) - every time I run the program lofreq viterbi, which is used before variant calling with lofreq. When I generate a bam with the same reference file and fastq files with bowtie2 I do not get the same error.

I have tried using reformat.sh to convert to cigar 1.3 but this doesn't seem to work. The fasta file has only one sequence and there are no spaces in the name.

Here is an example of the error with the command -

lofreq viterbi -f ZIKV_PRVABC59_CDS.fa -o bbmapv.bam bbmap.bam
Segmentation fault (core dumped)

It runs OK with bowtie produced bam.

Here is the output from the command head with either bowtie or bbmap produced sam file.

bbmap

@HD     VN:1.4  SO:unsorted
@SQ     SN:ZIKV_PRVABC59_CDS    LN:10272
@PG     ID:BBMap        PN:BBMap        VN:37.47        CL:java -Djava.library.path=/home/weger/bb
p/jni/ -ea -Xmx216859m align2.BBMap build=1 overwrite=true fastareadlen=500 in1=1_ctff_R1.fq.gz in
1_ctff_R2.fq.gz out=1_bbmap.sam ref=ZIKV_PRVABC59_CDS.fa maq=25
NS500697:37:HH5V7BGXY:2:23303:13708:4313 1:N:0:TAAGGCGA+ATATAGAG        77      *       0       0
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT   AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEAE/EEEA/AEEEE/EA
NS500697:37:HH5V7BGXY:2:23303:13708:4313 1:N:0:TAAGGCGA+ATATAGAG        141     *       0       0
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA      AAAE<6<<<66<<<<<6<<6666666666666E66666666E66E666A6666A66AA
E6EAA6EAAAEAEAEAEEAEEAEEEEEAE6EAEAAEAAAEEEAEAEAAEEEEAEAEEAEEEEEEEEAEEEEEEEE
NS500697:37:HH5V7BGXY:2:21207:1798:4356 1:N:0:TAAGGCGA+ATAGAGAC 77      *       0       0       *
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT  AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEEAEEE//EEEEE//E
NS500697:37:HH5V7BGXY:2:21207:1798:4356 1:N:0:TAAGGCGA+ATAGAGAC 141     *       0       0       *
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6666666666<<<<<<666666666666666666666666
NS500697:45:HJGYTAFXX:2:11101:23195:4485 1:N:0:TAAGGCGA+ATAGAGAG        77      *       0       0
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTT  AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEAE<EE<A/EA//E
NS500697:45:HJGYTAFXX:2:11101:23195:4485 1:N:0:TAAGGCGA+ATAGAGAG        141     *       0       0
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A6A6<<<6<<E<<<<<6<<6<6<<<<<6666<<<<6666E66E6666666EE6666E66EEEE666
6AAAAAAAEA6EAAEAAE6E6EAE6EAEEAEAAEAEAEEEAEEEAAEEAEEEEEEAEEEEAEAE
NS500697:37:HH5V7BGXY:2:22101:16007:4646 1:N:0:TAAGGCGA+ATAGAGAG        77      *       0       0
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT      AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEE/AE/EEA//A

bowtie2

@HD     VN:1.0  SO:unsorted
@SQ     SN:ZIKV_PRVABC59_CDS    LN:10272
@PG     ID:bowtie2      PN:bowtie2      VN:2.2.9        CL:"/apps/bowtie2-2.2.9/bowtie2-align-s --
apper basic-0 -x /data/ebel_lab/Weger/indexed_fasta_bowtie/ZIKV__PRVABC59_CDS -S 1_bowtie.sam -1 /
p/31806.inpipe1 -2 /tmp/31806.inpipe2"
NS500697:37:HH5V7BGXY:4:13502:9896:14279        77      *       0       0       *       *       0
AGCCTAAGTATGTCAATACAACAAATACTTACTGTTTCATTTCTAGTAATGAAAAAAAAAAAAAAAA     AAAAAEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EE        YT:Z:UP
NS500697:37:HH5V7BGXY:4:13502:9896:14279        141     *       0       0       *       *       0
CAGAGACATACCCCTCCTTACAAATAAAAATGTTCTTTATAGATGTAAATTTATTTTACAAAAATGTTTCAAAATGACCAGATGAAAATCATCCTTAT
CAGAAAGACTTGTTTTTTTTTTTTTAAT    AAAAAEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEAEEE/AEEEEEEEEEEEEEEEE/<E   YT:Z:UP
NS500697:37:HH5V7BGXY:4:12605:4827:14803        77      *       0       0       *       *       0
AGCCTAAGTATGTCAATACAACAAATACTTACTGTTTCATTTCTAGTAATGAAAAAAAAAAAAACAA     AAAAAEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEEEEEEAEEAEEEEEEEEEEEEEEEEAEE        YT:Z:UP
NS500697:37:HH5V7BGXY:4:12605:4827:14803        141     *       0       0       *       *       0
CAGAGACATACCCCTCCTTACAAATAAAAATGTTCTTTATAGATGTAAATTTATTTTACAAAAATGTTTCAAAATGACCAGATGAAAATCATCCTTAT
CAGAAAGACTTGTTTTTTTTTTTTTAATT   AAAAAEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEA<AEEEEEEEEEEEEEEEEEEEEEEE<<<E  YT:Z:UP
NS500697:37:HH5V7BGXY:4:22607:4886:15556        77      *       0       0       *       *       0
AGCCTAAGTATGTCAATACAACAAATACTTACTGTTTCATTTCTAGTAATGAAAAAAAAAAAAAAAA     AAAAAEEEEEEEEEAEEAEEEEEEEE
E/EEEAE/AAEEEEEEAAEEEEEAA6EEE6EEEEEEEE/E        YT:Z:UP
NS500697:37:HH5V7BGXY:4:22607:4886:15556        141     *       0       0       *       *       0
AGAGACATACCCCTCCTTACAAATAAAAATGTTCTTTATAGATGTAAATTTATTTTACAAAAATGTTTCAAAATGACCAGATGAAAATCATCCTTATG
AGAAAGACTTGTTTTTTTTTTTTTTAATTA  AAAAEEEEEEA/EAEEEEEEAEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEE
EEEEEEEEEEAEEAEEEEEEEAEEEEEEAEAAE/AEAAEEEEE6E/EEEAEEAEEEEA//<EA YT:Z:UP
NS500697:37:HH5V7BGXY:4:12507:9984:15827        77      *       0       0       *       *       0
AGCCTAAGTATGTCAATACAACAAATACTTACTGTTTCATTTCTAGTAATGAAAAAAAAAAAAAAAAGTCTTTAT     AAAAAEAEEEEEEEEEEE
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6E6EEE/EEEEE/EE/E6EAE/E        YT:Z:UP

Any ideas you might have would be greatly appreciated.

Thanks in advance.

[lucila]

Hi Lucila,

No, it does not, but I have been considering adding gff output, at least for exon boundaries, if not full transcripts. For generating a reference transcriptome, you can do either mapping or assembly; so, assemblers like Trinity are also an option.

I have not tried it, but you may also want to examine this:
https://github.com/enormandeau/gawn

Thank you Brian for the information!!
Cheers,
Lucila.

[Brian Bushnell]

Hi Brian,
thank you so much for this useful tool. I would like to ask you a question. Does BBMap generate a list of transcripts as a result of the mapping of the reads? What I mean is if this tool generates a fasta file of reconstructed transcripts based on the reference genome and the reads used for mapping.
I need this because the genome that I am using is not annotated (I mean, I do not have a gff) and I want to generate a reference transcriptome using my reads and the genome.

Hi Lucila,

No, it does not, but I have been considering adding gff output, at least for exon boundaries, if not full transcripts. For generating a reference transcriptome, you can do either mapping or assembly; so, assemblers like Trinity are also an option.

I have not tried it, but you may also want to examine this:

https://github.com/enormandeau/gawn

[lucila]

Hi Brian,
thank you so much for this useful tool. I would like to ask you a question. Does BBMap generate a list of transcripts as a result of the mapping of the reads? What I mean is if this tool generates a fasta file of reconstructed transcripts based on the reference genome and the reads used for mapping.
I need this because the genome that I am using is not annotated (I mean, I do not have a gff) and I want to generate a reference transcriptome using my reads and the genome.

Thank you again!
Best,
Lucila.

[Brian Bushnell]

Thanks that's helpful. On the note of loading references - is there a way to use wildcards with the input and output of bbwrap?

Ah, sorry, but nope. You can, however, do something like...

ls *.fastq.gz > ls.txt

...then replace '\n' with ',' using a text editor (like Notepad++). I'm sure there's a simpler sed/awk solution, too.

[darthsequencer]

To maximize speed when you are not looking for low-identity matches, "fast" (plus your identity threshold) is generally adequate. You can also speed it up by reducing "maxindel" (fast sets it to 80). Quality-trimming and adapter-trimming generally increase alignment speed.

With a large reference you may be able to increase speed with "k=14" instead of the default "k=13" - this increases the time to load the reference and memory usage, but increases mapping speed (so whether the process becomes faster or slower depends on how long it takes to load the reference compared to how much data you have to map). Also, turning off mate rescue (rescue=f) or reducing rescuedist (fast defaults to rescuedist=800) can also increase the speed slightly. Note that all of these options reduce sensitivity (aside from trimming which increases it), but at 97% identity you only need very low sensitivity anyway.

Thanks that's helpful. On the note of loading references - is there a way to use wildcards with the input and output of bbwrap?

[darthsequencer]

How long are the query sequences?

They range between 50bp single end to 2 x 250bp

[Brian Bushnell]

To maximize speed when you are not looking for low-identity matches, "fast" (plus your identity threshold) is generally adequate. You can also speed it up by reducing "maxindel" (fast sets it to 80). Quality-trimming and adapter-trimming generally increase alignment speed.

With a large reference you may be able to increase speed with "k=14" instead of the default "k=13" - this increases the time to load the reference and memory usage, but increases mapping speed (so whether the process becomes faster or slower depends on how long it takes to load the reference compared to how much data you have to map). Also, turning off mate rescue (rescue=f) or reducing rescuedist (fast defaults to rescuedist=800) can also increase the speed slightly. Note that all of these options reduce sensitivity (aside from trimming which increases it), but at 97% identity you only need very low sensitivity anyway.

[GenoMax]

Hi Brian,
I have a lot of reference sequences I'm mapping to (~11 million)

How long are the query sequences?

[darthsequencer]

bbmap fast macro?

Hi Brian,
I have a lot of reference sequences I'm mapping to (~11 million) and want to eek out as much as speed as possible.

I'm mostly looking for close matches - ex. I set minid to 0.97. Will setting fast still find matches like that? Any other thoughts on what I can set to get more speed?

Thanks a bunch!

[darthsequencer]

It is tied to the number of threads defined for BBMap, just for some reason I capped it at a max of 8 even if the main process was allowed to use more; probably to conserve memory. I've increased it to a max of 64.

Thanks- that helps a lot!

[Brian Bushnell]

How about tying the number to the number of threads specified for BBMap? That way we know that many threads are available.

It is tied to the number of threads defined for BBMap, just for some reason I capped it at a max of 8 even if the main process was allowed to use more; probably to conserve memory. I've increased it to a max of 64.

[GenoMax]

Oh, yep, for some reason I capped it at 8 threads. I wonder why? I'll eliminate that cap in the next release, which will probably be sometime today.

How about tying the number to the number of threads specified for BBMap? That way we know that many threads are available.

[Brian Bushnell]

Oh, yep, for some reason I capped it at 8 threads. I wonder why? I'll eliminate that cap in the next release, which will probably be sometime today.