Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    Hi Kate,

    That's odd... I will investigate and see if I can figure out why that's happening. minid and idfilter are slightly different, but certainly with idfilter=0.95 you should not get any alignments with under 95% identity.

    -Brian

    Comment

    • sk8bro
      Member
      • Feb 2012
      • 30

      Thanks so much! I can try to replicate the issue and email you a small dataset/reference if that would help? Just let me know. BBsplit is otherwise really fantastic!

      Kate

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        Hi Kate,

        Yes, please do that - it would be very helpful.

        -Brian

        Comment

        • schalivendra
          Junior Member
          • Mar 2013
          • 2

          BBMap

          Hi,

          How I can cite BBMap? Is there a publication that I can list under references?

          thanks very much,
          SC

          Comment

          • Brian Bushnell
            Super Moderator
            • Jan 2014
            • 2709

            Hi SC,

            No publication yet, so for now, please cite it like this:

            "BBMap - Bushnell B. - sourceforge.net/projects/bbmap/"

            ...or similar, depending on the style guidelines.

            Comment

            • nlubock
              Junior Member
              • Jun 2016
              • 3

              BBMap Error

              Hi Brian,

              I'm getting the following error when using BBMap (Version 36.11) for some of my alignments:

              Code:
              java -Djava.library.path=/usr/local/stow/bbmap_36.11/bin/jni/ -ea -Xmx8g -cp /usr/local/stow/bbmap_36.11/bin/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 in=1_nonDoped.adapters.fastq vslow=t k=8 ref=../ref-seq.fasta mdtag=t -Xmx8g outm=bbmap.sam nodisk
              Executing align2.BBMap [tipsearch=150, minhits=1, minratio=0.25, rescuemismatches=50, rescuedist=3000, build=1, overwrite=true, fastareadlen=500, in=1_nonDoped.adapters.fastq, k=8, ref=../ref-seq.fasta, mdtag=t, -Xmx8g, outm=bbmap.sam, nodisk]
              
              BBMap version 36.11
              Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.250
              Retaining first best site only for ambiguous mappings.
              Executing dna.FastaToChromArrays2 [../ref-seq.fasta, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=false, minscaf=1, midpad=300, startpad=8000, stoppad=8000, nodisk=true]
              
              Set genScaffoldInfo=true
              Set genome to 1
              
              Loaded Reference:	0.001 seconds.
              Loading index for chunk 1-1, build 1
              Indexing threads started for block 0-1
              Indexing threads finished for block 0-1
              Generated Index:	0.013 seconds.
              Analyzed Index:   	0.031 seconds.
              Started output stream:	0.022 seconds.
              Cleared Memory:    	0.123 seconds.
              Processing reads in single-ended mode.
              Started read stream.
              Started 40 mapping threads.
              Exception in thread "Thread-25" java.lang.ArrayIndexOutOfBoundsException: 136
              	at align2.BBIndex.getOffsetArray(BBIndex.java:3065)
              	at align2.BBIndex.shrink2(BBIndex.java:830)
              	at align2.BBIndex.find(BBIndex.java:443)
              	at align2.BBIndex.findAdvanced(BBIndex.java:396)
              	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:736)
              	at align2.BBMapThread.processRead(BBMapThread.java:405)
              	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
              Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39
              
              **************************************************************************
              Warning!  1 mapping thread did not terminate normally.
              Check the error log; the output may be corrupt or incomplete.
              Please submit the full stderr output as a bug report, not just this message.
              **************************************************************************
              
              
              
              
                 ------------------   Results   ------------------
              
              Genome:                	1
              Key Length:            	8
              Max Indel:             	16000
              Minimum Score Ratio:  	0.25
              Mapping Mode:         	normal
              Reads Used:           	570587	(170899784 bases)
              
              Mapping:          	34.755 seconds.
              Reads/sec:       	16417.62
              kBases/sec:      	4917.33
              
              
              Read 1 data:      	pct reads	num reads 	pct bases	   num bases
              
              mapped:          	 99.9855% 	   570504 	 99.9840% 	   170872487
              unambiguous:     	 99.9855% 	   570504 	 99.9840% 	   170872487
              ambiguous:       	  0.0000% 	        0 	  0.0000% 	           0
              low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0
              
              perfect best site:	 62.1351% 	   354535 	 62.2356% 	   106360500
              semiperfect site:	 62.1351% 	   354535 	 62.2356% 	   106360500
              
              Match Rate:      	      NA 	       NA 	 99.7089% 	   170661054
              Error Rate:      	 37.4881% 	   213882 	  0.2887% 	      494106
              Sub Rate:        	 28.9387% 	   165105 	  0.1164% 	      199217
              Del Rate:        	 10.8304% 	    61791 	  0.1676% 	      286801
              Ins Rate:        	  1.1807% 	     6736 	  0.0047% 	        8088
              N Rate:          	  0.6976% 	     3980 	  0.0024% 	        4128
              Exception in thread "main" java.lang.AssertionError:
              The number of reads out does not add up to the number of reads in.
              This may indicate that a mapping thread crashed.
              If you submit a bug report, include the entire console output, not just this error message.
              570504+0+0+82+0 = 570586 != 570587
              	at align2.AbstractMapper.printOutput(AbstractMapper.java:1867)
              	at align2.BBMap.testSpeed(BBMap.java:489)
              	at align2.BBMap.main(BBMap.java:33)
              Any insights would be greatly appreciated!

              Comment

              • Brian Bushnell
                Super Moderator
                • Jan 2014
                • 2709

                It looks like the problem is that some of the internal buffers were not sized correctly for a situation with such long reads and such a short kmer length in conjunction with vslow (which increases the number of seed kmers used per read). You can probably resolve this by using mapPacBio.sh instead of bbmap.sh, which uses larger buffers. How long are the sequences you are mapping? It looks like almost all of them are ~300bp long, but perhaps one read is longer? Also... what are you mapping, and to what?

                Alternatively, using a longer kmer length (such as the default of 13) seems like it would be fine in this case. 62% of your reads match the reference perfectly and there's an overall average error rate of 0.288% (average identity of 99.71%) so it does not seem like such extremely sensitive settings are necessary, though it depends on what you are doing. Decreasing K can improve sensitivity when dealing with extremely high error rates, but strange things (like this buffer overflow) can happen if you make it too low. bbmap.sh is tuned for normal Illumina reads being mapped to a genome or transcriptome. For situations with extremely high error rates, or when very small kmer lengths are needed, or with very long reads, I recommend using mapPacBio.sh instead. Also, for small values of K (below 11) I recommend reducing "maxindel" as well.

                That said, I'll make this buffer slightly bigger - hopefully that will circumvent this problem in the future.

                Comment

                • nlubock
                  Junior Member
                  • Jun 2016
                  • 3

                  Thanks for the quick response!

                  I'm basically trying to detect every error in a single amplicon with Illumina sequencing. Ideally, I would be able to map every read back to the reference and use the resulting alignments to quantify the errors. I tried to max out every sensitivity parameter in hopes of catching as many errors as possible.

                  In this case, our reads should be ~300 bp and I'm mapping them onto a single perfect 300 bp reference. Upping the kmer size to 9 with bbmap.sh avoids the overflow, although mapPacBio.sh is throwing this error:

                  Code:
                  java -Djava.library.path=/usr/local/stow/bbmap_36.11/bin/jni/ -ea -Xmx79769m -cp /usr/local/stow/bbmap_36.11/bin/current/ align2.BBMapPacBio build=1 overwrite=true minratio=0.40 fastareadlen=6000 ambiguous=best minscaf=100 startpad=10000 stoppad=10000 midpad=6000 in=../2_merge/1_nonDoped.adapters.fastq ref=../ref-seq.fasta vslow=t t=30 k=8 outm=pacbio.sam overwrite=t mdtag=t maxindel=100 nodisk
                  Executing align2.BBMapPacBio [tipsearch=22, minhits=1, minratio=0.25, rescuemismatches=50, rescuedist=3000, build=1, overwrite=true, minratio=0.40, fastareadlen=6000, ambiguous=best, minscaf=100, startpad=10000, stoppad=10000, midpad=6000, in=../2_merge/1_nonDoped.adapters.fastq, ref=../ref-seq.fasta, t=30, k=8, outm=pacbio.sam, overwrite=t, mdtag=t, maxindel=100, nodisk]
                  
                  BBMap version 36.11
                  Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.250
                  Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.400
                  Set threads to 30
                  Retaining first best site only for ambiguous mappings.
                  Executing dna.FastaToChromArrays2 [../ref-seq.fasta, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=false, minscaf=100, midpad=6000, startpad=10000, stoppad=10000, nodisk=true]
                  
                  Set genScaffoldInfo=true
                  Set genome to 1
                  
                  Loaded Reference:	0.001 seconds.
                  Loading index for chunk 1-1, build 1
                  Indexing threads started for block 0-1
                  Indexing threads finished for block 0-1
                  Generated Index:	0.011 seconds.
                  Analyzed Index:   	0.024 seconds.
                  Started output stream:	0.014 seconds.
                  Cleared Memory:    	0.132 seconds.
                  Processing reads in single-ended mode.
                  Started read stream.
                  Started 30 mapping threads.
                  Exception in thread "Thread-6" Exception in thread "Thread-35" Exception in thread "Thread-34" Exception in thread "Thread-33" Exception in thread "Thread-32" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-31" Detecting finished threads: 0java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-30" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-29" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-28" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-27" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-26" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-25" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-24" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-23" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-22" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-21" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-19" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-20" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-18" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-17" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-15" Exception in thread "Thread-16" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-14" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-13" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-12" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-11" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-10" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-9" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-8" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  Exception in thread "Thread-7" java.lang.AssertionError: 10.75, 8
                  	at align2.KeyRing.desiredKeysFromDensity(KeyRing.java:271)
                  	at align2.KeyRing.makeOffsets3(KeyRing.java:437)
                  	at align2.AbstractMapThread.quickMap(AbstractMapThread.java:683)
                  	at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:399)
                  	at align2.AbstractMapThread.run(AbstractMapThread.java:495)
                  , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
                  
                  **************************************************************************
                  Warning!  30 mapping threads did not terminate normally.
                  Check the error log; the output may be corrupt or incomplete.
                  Please submit the full stderr output as a bug report, not just this message.
                  **************************************************************************
                  
                  
                  
                  
                     ------------------   Results   ------------------
                  
                  Genome:                	1
                  Key Length:            	8
                  Max Indel:             	100
                  Minimum Score Ratio:  	0.4
                  Mapping Mode:         	normal
                  Reads Used:           	30	(8996 bases)
                  
                  Mapping:          	17.908 seconds.
                  Reads/sec:       	1.68
                  kBases/sec:      	0.50
                  
                  
                  Read 1 data:      	pct reads	num reads 	pct bases	   num bases
                  
                  mapped:          	  0.0000% 	        0 	  0.0000% 	           0
                  unambiguous:     	  0.0000% 	        0 	  0.0000% 	           0
                  ambiguous:       	  0.0000% 	        0 	  0.0000% 	           0
                  low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0
                  
                  perfect best site:	  0.0000% 	        0 	  0.0000% 	           0
                  semiperfect site:	  0.0000% 	        0 	  0.0000% 	           0
                  
                  Match Rate:      	      NA 	       NA 	     NaN% 	           0
                  Error Rate:      	     NaN% 	        0 	     NaN% 	           0
                  Sub Rate:        	     NaN% 	        0 	     NaN% 	           0
                  Del Rate:        	     NaN% 	        0 	     NaN% 	           0
                  Ins Rate:        	     NaN% 	        0 	     NaN% 	           0
                  N Rate:          	     NaN% 	        0 	     NaN% 	           0
                  Exception in thread "main" java.lang.AssertionError:
                  The number of reads out does not add up to the number of reads in.
                  This may indicate that a mapping thread crashed.
                  If you submit a bug report, include the entire console output, not just this error message.
                  0+0+0+0+0 = 0 != 30
                  	at align2.AbstractMapper.printOutput(AbstractMapper.java:1867)
                  	at align2.BBMapPacBio.testSpeed(BBMapPacBio.java:458)
                  	at align2.BBMapPacBio.main(BBMapPacBio.java:35)

                  Comment

                  • susanklein
                    Senior Member
                    • Feb 2014
                    • 116

                    miRNA

                    Hi,

                    has anyone used bbmap to map miRNAs to mirDB or similar. Any idea what settings would be best? I need to get count data.

                    Thanks,

                    S.

                    Comment

                    • GenoMax
                      Senior Member
                      • Feb 2008
                      • 7142

                      Originally posted by susanklein View Post
                      Hi,

                      has anyone used bbmap to map miRNAs to mirDB or similar. Any idea what settings would be best? I need to get count data.

                      Thanks,

                      S.
                      @Brian recently offered this advice on this topic. You may want to modify the maxsites to suite your requirement.

                      Code:
                      When mapping small RNA's with BBMap use the following flags to report only perfect matches.
                      
                      Code:
                      ambig=all vslow perfectmode maxsites=1000
                      Lot of these gems are captured in this thread.

                      Comment

                      • susanklein
                        Senior Member
                        • Feb 2014
                        • 116

                        thanks, good to know bbmap should work, it is my favourite mapper. I'll try those parameters.

                        S.

                        Comment

                        • Brian Bushnell
                          Super Moderator
                          • Jan 2014
                          • 2709

                          Thanks, nlubock; you've allowed me to resolve 2 unexpected corner-cases with very short kmer lengths. I've released a new version (36.14) fixing both of them.

                          Comment

                          • nlubock
                            Junior Member
                            • Jun 2016
                            • 3

                            Thank you! Love the product.

                            I'm not sure if this is a bug as well, but I noticed that some of the MD Tags in my output files are missing 0's between adjacent mismatches. However, if there is a deletion and then a mismatch, bbmap.sh will add a 0.

                            For example, if I align the following fasta file:
                            Code:
                            >perf
                            CATCAGGACCAAGACTGGGGAGATCATCTCTGCTGTCCACATTGAAGCCT
                            >mm-at-25-26
                            CATCAGGACCAAGACTGGGGAGATGGTCTCTGCTGTCCACATTGAAGCCT
                            >del-24-mm-at-25-26
                            CATCAGGACCAAGACTGGGGAGAGGTCTCTGCTGTCCACATTGAAGCCT
                            >del-24-mm-at-25
                            CATCAGGACCAAGACTGGGGAGAGATCTCTGCTGTCCACATTGAAGCCT
                            back onto the perfect sequence, and then run the resulting sam file through samtools calmd, I get:
                            Code:
                            50
                            24CA24    -> 24C0A24
                            23^T0CA24 -> 23^T0C0A24
                            23^T0C25
                            Maybe this is a samtools convention? The official spec was not very clear...

                            Comment

                            • Brian Bushnell
                              Super Moderator
                              • Jan 2014
                              • 2709

                              There is no official spec for MD tags as far as I know; it's basically defined by usage. The sam PDF just provides vague guidance. I think 0's are optional for adjacent mismatches and there is no indication otherwise in the sam spec. For a deletion followed by a mismatch, the 0 allows you to visually determine how long the deletion is without looking at the cigar string (otherwise it would be hard to visually distinguish between ^AC meaning "deletion of A followed by mismatch of C" versus "deletion of AC". But when combined with the cigar string there is no ambiguity, so they are both correct. Especially considering MD tags have no formal specification For machine-processing, there's no reason to have 0's and they just waste space.

                              Comment

                              • parulagwl
                                Junior Member
                                • Jul 2014
                                • 6

                                We have been liking our first experiences with BBmap for our wheat data and are impressed. And it works well when we use parts of a wheat chromosome for both indexing and mapping. However, when we move from using parts of a chromosome to a whole chromosome (e.g. chr 3B approx. 850 million bases) we get the following error during indexing:

                                bbmap.sh k=14 ref=3B.fa

                                java -Djava.library.path=/software/bbmap/bbmap/jni/ -ea -Xmx119912m -cp /software/bbmap/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 k=14 ref=3B.fa

                                Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, k=14, ref=3B.fa]

                                BBMap version 35.74

                                Retaining first best site only for ambiguous mappings.
                                No output file.

                                NOTE: Ignoring reference file because it already appears to have been processed.
                                NOTE: If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt

                                Set genome to 1

                                Loaded Reference: 0.008 seconds.

                                Exception in thread "main" java.lang.AssertionError: 1, 0
                                at align2.BBIndex.loadIndex(BBIndex.java:94)
                                at align2.BBMap.loadIndex(BBMap.java:361)
                                at align2.BBMap.main(BBMap.java:31)

                                If we split Chr 3B into two fasta sequences and run it works fine and dandy. Have also tried BBmap v36.20 and get the same error. I'm guessing there is a limitation on Chr size? Is there a way to adjust this?
                                Many Thanks.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  Today, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 11:10 AM
                                0 responses
                                8 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                30 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-09-2026, 10:04 AM
                                0 responses
                                39 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-08-2026, 10:08 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...