Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #496
    Can you post an example of a read that is not getting trimmed with the command you posted?

    Also, "ktrim=rl" with BBDuk won't work; it only allows "ktrim=r" or "ktrim=l". I've changed it now so in the next release it will print an error message if you use other values.

    Comment

    • jweger1988
      Member
      • Apr 2017
      • 37

      #497
      Brian,

      Thanks for the response. My issue was exactly that. It seems to be working fine now by only using one at a time. The other issue was a hamming distance thing that I also figured out.

      Will you be incorporating the soft-clipped base trimming in this next update?

      Thanks again.

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #498
        Originally posted by Mchicken View Post
        Thanks a lot for your helpful replies. It is now working perfectly . One more question to the "xstag". I see that if the gene is on the + strand, R2 maps on+ and R1 maps on -. If I use "xstag=ss" I get for spliced R1 and R2 reads XS=+. So I think this is the correct library type. Am I right?
        I think so. I've always found Tophat's description of those terms to be very confusing, so I have trouble remember for more than a few days which is the correct one to use and when.

        Originally posted by jweger1988
        Will you be incorporating the soft-clipped base trimming in this next update?
        Yes, I have added that as of v37.23 which I just released. The flag is "trimclip", for example:

        bbduk.sh in=mapped.sam out=trimmed.sam trimclip ordered

        You can also output them as fastq if you want.

        Comment

        • jweger1988
          Member
          • Apr 2017
          • 37

          #499
          Hi Brian,

          I have a couple of questions.

          I've been comparing different alignment programs and then some different variant calling software. For some reason when I use a bam file produced with bbmap and try to call variants with lofreq I get an error message, but not with bam files produced with other programs (bowtie, mosaic, etc...). Even after sorting the bam I get the same message. Any thoughts on why this might be?

          Also, I'm wondering if it's possible to use dedupe with the input as either paired fastq files (i.e. in1 and in2) or a bam file?

          Thanks,
          James

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #500
            Not sure if this is applicable but BBMap produces SAM v.1.4 CIGAR strings by default. If your variant calling program expects v.1.3 format then you can either add sam=1.3 option when you align (or reformat.sh in=your.bam out=new.bam sam=1.3).

            Dedupe can be used with PE files but only if reads are interleaved. You may want to use clumpify instead of dedupe.

            Comment

            • jweger1988
              Member
              • Apr 2017
              • 37

              #501
              Genomax,

              Awesome, changing CIGAR fixed the issue. Thanks.

              About Clumpify vs Dedupe, that's a good idea. I remember Brian saying somewhere that clumpify is not quite as good as Dedupe? What would be your recommended settings?

              Thanks

              Comment

              • GenoMax
                Senior Member
                • Feb 2008
                • 7142

                #502
                If you wanted to use dedupe with PE files you could do it this way
                Code:
                reformat.sh in1=R1.fq in2=R2.fq out=stdout.fq | dedupe.sh in=stdin.fq out=stdout.fq | reformat.sh in=stdin.fq out1=new1.fq out2=new2.fq
                Clumpify is more flexible compared to dedupe. You can select what happens to the duplicates. You may be interested in this option:
                Code:
                dedupe=t optical=f
                All duplicates are detected, whether optical or not.  All copies except one are removed for each duplicate.

                Comment

                • sk8bro
                  Member
                  • Feb 2012
                  • 30

                  #503
                  minid and idfilter

                  Hi Brian,

                  Thank you for making the deterministic flag. Results in that regard look great.

                  I am confused by how minid and idfilter are working, however. I will email you a small dataset that recreates the 'unexpected' behavior I am encountering if that is helpful.

                  My expectation is that this command should only allow alignments where BOTH the forward and reverse read, independently align with at least 75% pairwise identity to the reference.... ie overlap in the reads is NOT taken into account and a contig pairwise identity to the reference is NOT what the setting is referring to. Note: I usually output 4 fastqs for mapped/unmapped pairs but have changed to sam output and specified the idtag flag to give more info.
                  Code:
                  bbsplit.sh\
                   -Xmx23g\
                   averagepairdist=200\
                   deterministic=t\
                   k=8\
                   minid=0.75\
                   idfilter=0.75\
                   maxindel=20\
                   nzo=f\
                   po=t\
                   ambiguous2=split\
                   ref=test_ref\
                   idtag=t\
                   in=Input_1P.fastq\
                   in2=Input_2P.fastq\
                   outm=Mapped.sam\
                   outu=Unmapped.sam\
                  Here is the head of Mapped.sam... how are these mapping? YI:f:73.10, YI:f:64.14 etc...
                  Code:
                  @HD     VN:1.4  SO:unsorted
                  @SQ     SN:006_Koxy_tonB_PC     LN:317
                  @SQ     SN:022_NDM_PC   LN:267
                  @PG     ID:BBMap        PN:BBMap        VN:37.22        CL:java -Djava.library.path=/install/bbmap/jni/ -ea -Xmx23g align2.BBSplitter ow=t fastareadlen=500 minhits=1 minratio=0.56 maxindel=20 qtrim=rl untrim=t trimq=6 -Xmx23g averagepairdist=200 deterministic=t k=8 minid=0.75 idfilter=0.75 maxindel=20 nzo=f po=t ambiguous2=split ref=test_ref idtag=t in=Input_1P.fastq in2=Input_2P.fastq outm=Mapped.sam outu=Unmapped.sam
                  gi|828959694|gb|CP011636.1|_Klebsiella_oxytoca_strain_CAV1374,_complete_genome_(reversed)-1-146 83      006_Koxy_tonB_PC        209     18      4=2X2=37I100=   =       6       -311    ATCAAGCTGTTTGCCGGGAATAACAACCAGCGCGGGGCGGCGTTTGACGTTACCGGGGCGCTGGACGATAACGATCGCGTGGCGGCGCGCTTAAGCGGCATGACCCGCTATGCAGACTCGCAGTTTGATACCTTAAAAGAGCAGC  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????  NM:i:39 AM:i:18 YI:f:73.10
                  gi|828959694|gb|CP011636.1|_Klebsiella_oxytoca_strain_CAV1374,_complete_genome_(reversed)-1-146 163     006_Koxy_tonB_PC        6       9       87=1X2=47I1X1=1X3=2X    =       209     311     AATGATGGGCGATACCAACTCGCACAGCTCGCTGGTGGTCGATCCGTGGTTCCTGGAAAATATCGAAGTGGTGCGCGGCCCGGCCTCAGTGCTGTACGGCCGCTCTTCGCCCGGCGGCATCGTCGCCCTCACCTCGCGTAAACCC  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????  NM:i:52 AM:i:9  YI:f:64.14
                  gi|828959694|gb|CP011636.1|_Klebsiella_oxytoca_strain_CAV1374,_complete_genome_(reversed)-1-146 83      006_Koxy_tonB_PC        209     18      4=2X2=37I100=   =       6       -311    ATCAAGCTGTTTGCCGGGAATAACAACCAGCGCGGGGCGGCGTTTGACGTTACCGGGGCGCTGGACGATAACGATCGCGTGGCGGCGCGCTTAAGCGGCATGACCCGCTATGCAGACTCGCAGTTTGATACCTTAAAAGAGCAGC  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????  NM:i:39 AM:i:18 YI:f:73.10
                  gi|828959694|gb|CP011636.1|_Klebsiella_oxytoca_strain_CAV1374,_complete_genome_(reversed)-1-146 163     006_Koxy_tonB_PC        6       9       87=1X2=47I1X1=1X3=2X    =       209     311     AATGATGGGCGATACCAACTCGCACAGCTCGCTGGTGGTCGATCCGTGGTTCCTGGAAAATATCGAAGTGGTGCGCGGCCCGGCCTCAGTGCTGTACGGCCGCTCTTCGCCCGGCGGCATCGTCGCCCTCACCTCGCGTAAACCC  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????  NM:i:52 AM:i:9  YI:f:64.14
                  gi|828959694|gb|CP011636.1|_Klebsiella_oxytoca_strain_CAV1374,_complete_genome_(reversed)-1-146 83      006_Koxy_tonB_PC        209     18      4=2X2=37I100=   =       6       -311    ATCAAGCTGTTTGCCGGGAATAACAACCAGCGCGGGGCGGCGTTTGACGTTACCGGGGCGCTGGACGATAACGATCGCGTGGCGGCGCGCTTAAGCGGCATGACCCGCTATGCAGACTCGCAGTTTGATACCTTAAAAGAGCAGC  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????  NM:i:39 AM:i:18 YI:f:73.10
                  gi|828959694|gb|CP011636.1|_Klebsiella_oxytoca_strain_CAV1374,_complete_genome_(reversed)-1-146 163     006_Koxy_tonB_PC        6       9       87=1X2=47I1X1=1X3=2X    =       209     311     AATGATGGGCGATACCAACTCGCACAGCTCGCTGGTGGTCGATCCGTGGTTCCTGGAAAATATCGAAGTGGTGCGCGGCCCGGCCTCAGTGCTGTACGGCCGCTCTTCGCCCGGCGGCATCGTCGCCCTCACCTCGCGTAAACCC  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????  NM:i:52 AM:i:9  YI:f:64.14
                  Thanks, Kate
                  Last edited by GenoMax; 05-17-2017, 03:39 PM.

                  Comment

                  • darthsequencer
                    Member
                    • Feb 2012
                    • 35

                    #504
                    Originally posted by darthsequencer View Post
                    Great! Yeah I'd like to know the duplicate membership for containments too.
                    Hi Brian - I think "renamecluster=t" in dedupe.sh will do what I want with regards to tracking which contigs are greater than "minidentity".

                    I run dedupe.sh like this: dedupe.sh in=file.fa out=file.fa mindentity=99

                    Will adding "renameclusters=t" change what dedupe is doing besides renaming the sequences to what cluster they belong?

                    Comment

                    • Brian Bushnell
                      Super Moderator
                      • Jan 2014
                      • 2709

                      #505
                      No, it doesn't change the behavior otherwise. But for clustering you may want to disable duplicate removal (or you won't get accurate cluster sizes) with "am=f ac=f" and you need to add some clustering flags, "fo c pc".

                      So the command might look like:

                      dedupe.sh in=file.fa out=file.fa mindentity=99 am=f ac=f fo c pc

                      Comment

                      • darthsequencer
                        Member
                        • Feb 2012
                        • 35

                        #506
                        Originally posted by Brian Bushnell View Post
                        No, it doesn't change the behavior otherwise. But for clustering you may want to disable duplicate removal (or you won't get accurate cluster sizes) with "am=f ac=f" and you need to add some clustering flags, "fo c pc".

                        So the command might look like:

                        dedupe.sh in=file.fa out=file.fa mindentity=99 am=f ac=f fo c pc
                        Hi I gave that a shot and dedupe throws a bunch of errors and produces about double the clusters than dedupe does without clustering.

                        Here's a copy of log: https://www.dropbox.com/s/t8aqj7fgf2...er.fa.log?dl=0

                        Comment

                        • jweger1988
                          Member
                          • Apr 2017
                          • 37

                          #507
                          Hi Brian,

                          Is there a tool in the suite that will take a .gff or other annotation file and annotate a .vcf from callvariants.sh? By annotation I mean adding the result of the variant (i.e. AA change). I've tried to do it with a bunch of other tools but I'm having trouble.

                          I'm sure it's not currently supported, but is there any possibility that one could callvariants from a .gbk or .gff reference as opposed to a fasta to get the coding changes directly?

                          Thanks in advance.

                          Comment

                          • HESmith
                            Senior Member
                            • Oct 2009
                            • 512

                            #508
                            @jweger1988, what tools have you tried for VCF annotation and what problems have you encountered?

                            Comment

                            • jweger1988
                              Member
                              • Apr 2017
                              • 37

                              #509
                              @HESmith, thanks for the response.

                              I've tried Annovar, SnpEff and a few others. Do you have any experience with these or other recommendations? It's totally possibly I'm just messing this up.

                              I am working with a virus that is not in any of the database, I tried to build my own file in the database and was getting an error message about the file not having the correct chromosomes set (with SnpEff).

                              Any clues?

                              Comment

                              • HESmith
                                Senior Member
                                • Oct 2009
                                • 512

                                #510
                                Not trying to be a jerk, but have you tried variant calling with the test data that are included with the software? Success would eliminate installation and command errors as the source of your problem.

                                Also, a general rule for online troubleshooting of software problems is 1) to provide the exact command syntax that your used, and 2) report the exact error message that you received.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  New Genomics Technologies Take Aim at Long-Standing Limits
                                  by SEQadmin2


                                  Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                                  We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                                  ...
                                  Yesterday, 10:25 AM
                                • SEQadmin2
                                  How Immunogenomics Decodes Immunity’s Genetic Blueprint
                                  by SEQadmin2




                                  The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                                  This convergence of genetics, immunology, and computation...
                                  09-01-2026, 05:41 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 09:51 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-25-2026, 09:06 AM
                                0 responses
                                32 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-23-2026, 11:05 AM
                                0 responses
                                27 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-18-2026, 11:37 AM
                                1 response
                                48 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Working...