[GenoMax]

For the latest version of BBMap (BBMap_37.95.tar.gz), it looks like this issue might be fixed by changing line 183 of file 'bbmap/current/jgi/FindPrimers.java' to:

score2=ss.score=ss.quickScore;

I suggest that you create a ticket on BBMap SF site since you have specifically identified a fix.

[tabwalsh]

Bias towards forward strand in msa.sh

Hello Brian,

Thanks for the lovely tool. I've been using msa.sh with cutprimers.sh (as described here) to extract sequences between pairs of primers.

However, I got some unexpectedly large sequences as output, and when I took a look at the SAM alignments output by msa.sh, none of them are mapping to the reverse strand.

For example, with the following template sequence…

>template
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTGACACCCGTCAAGCCTCACGA

…it should be possible to use the following commands to extract the sequence between the given primers:

msa.sh in=template.fa primer=GGGGCCTAGACATTGCCCTCCA out=fwd.sam
msa.sh in=template.fa primer=GACACCCTGGCCGGTCAAGCCT out=rev.sam
cutprimers.sh in=template.fa sam1=fwd.sam sam2=rev.sam include=t out=amplicon.fa

This outputs the following (primer alignments shown in uppercase):

GGGGCCTAGACATTGCCCTCCAgagagagcacccaacaccctccaggcttgaccggccagggtgtccccttGACACCCGTCAAGCCT

The sequence GACACCCGTCAAGCCT is the best match for the reverse primer on the forward strand, but not the best match overall.

That is on the reverse strand, which would result in the following (primer alignments again in uppercase):

GGGGCCTAGACATTGCCCTCCAgagagagcacccaacaccctccAGGCTTGACCGGCCAGGGTGTC

For the latest version of BBMap (BBMap_37.95.tar.gz), it looks like this issue might be fixed by changing line 183 of file 'bbmap/current/jgi/FindPrimers.java' to:

score2=ss.score=ss.quickScore;

[SNPsaurus]

The reference in this case is a list of RAD loci sequences, each at 150 bp. The reads are 150 bp and should match one of the RAD loci. Since there are no N (or degenerate nucleotides) in the reference, and only a small number of reads with an N, it must have to do with the padding. A trimmed read would not have N padding, would it? This sample was degraded DNA, so plenty of reads were trimmed to less than 150 nucleotides. I doubt that 72% of the loci from this sample had an insertion that made the read extend past the reference (generated from consensus of many samples). Odd, but I guess it is not critical for me to fully figure this out.

[Brian Bushnell]

Hello, I've been using different parts of the BBMap suite and mixing them with other softwares for WGS of bacterial samples (primarily for the purpose of automated QC). I'm a fan of callvariants.sh as it works quickly and doesn't require me to sort .sam files before hand and it's simple to clearfilters to return all values. Unfortunately when using callvariants.sh with .sam files created from minimap2 (https://github.com/lh3/minimap2) using illumina nextseq reads. I receive the error seen below. I was curious if this was a minor bug that could be corrected?

I'm running callvariants.sh from bbmap v37.90 obtained from conda (https://anaconda.org/bioconda/bbmap). Appreciate any assistance given.

-Kim

Error:
java -ea -Xmx48779m -Xms48779m -cp /home/ssi.ad/kimn/.conda/envs/env_kim/opt/bbmap-37.90/current/ var2.CallVariants in=aln.sam ref=contigs.fasta vcf=minimap.vcf ploidy=1 clearfilters
Executing var2.CallVariants [in=aln.sam, ref=contigs.fasta, vcf=minimap.vcf, ploidy=1, clearfilters]

Loading reference.
Time: 0.304 seconds.
Processing input files.
Exception in thread "Thread-3" Exception in thread "Thread-4" Exception in thread "Thread-5" java.lang.AssertionError: TODO: Encountered a read with 'M' in cigar string but no MD tag.
at stream.SamLine.toShortMatch(SamLine.java:1200)
at stream.SamLine.toRead(SamLine.java:1972)
at stream.SamLine.toRead(SamLine.java:1832)
at stream.SamReadStreamer$ProcessThread.makeReads(SamReadStreamer.java:206)
at stream.SamReadStreamer$ProcessThread.run(SamReadStreamer.java:135)
java.lang.AssertionError: TODO: Encountered a read with 'M' in cigar string but no MD tag.
at stream.SamLine.toShortMatch(SamLine.java:1200)
at stream.SamLine.toRead(SamLine.java:1972)
at stream.SamLine.toRead(SamLine.java:1832)
at stream.SamReadStreamer$ProcessThread.makeReads(SamReadStreamer.java:206)
at stream.SamReadStreamer$ProcessThread.run(SamReadStreamer.java:135)
java.lang.AssertionError: TODO: Encountered a read with 'M' in cigar string but no MD tag.
at stream.SamLine.toShortMatch(SamLine.java:1200)
at stream.SamLine.toRead(SamLine.java:1972)
at stream.SamLine.toRead(SamLine.java:1832)
at stream.SamReadStreamer$ProcessThread.makeReads(SamReadStreamer.java:206)
at stream.SamReadStreamer$ProcessThread.run(SamReadStreamer.java:135)

The problem here is that minimap uses old-style cigar strings (M symbol instead of = and X) and also does not produce MD tags. I've added the ability to handle reads in that situation and it will be released in v37.95 (soon).

Prior to that you could probably add MD tags with "samtools calmd".

[Brian Bushnell]

This means 72 percent of the reads mapped with an "N" symbol in the match string, an internal data structure similar to a cigar string. The "N" symbol denotes either an N in the read or an N in the reference, which can include sequences that go off the end of scaffolds (the ends are internally padded with Ns). Additionally, degenerate IUPAC codes are counted as Ns.

[SNPsaurus]

I have a question about the bbmap summary output. Here is an example:

Reads Used:             1061591 (151284618 bases)

Mapping:                15.250 seconds.
Reads/sec:              69611.57
kBases/sec:             9920.17


Read 1 data:            pct reads       num reads       pct bases          num bases

mapped:                  76.2432%          809391        77.6086%          117409909
unambiguous:             75.3885%          800318        76.8084%          116199316
ambiguous:                0.8547%            9073         0.8002%            1210593
low-Q discards:           0.0000%               0         0.0000%                  0

perfect best site:       11.4049%          121073         9.7282%           14717263
semiperfect site:        58.9222%          625513        60.0540%           90852423

Match Rate:                   NA               NA        99.1429%          116413381
Error Rate:              20.6634%          183594         0.2527%             296692
Sub Rate:                19.9279%          177059         0.2369%             278137
Del Rate:                 0.6244%            5548         0.0084%               9819
Ins Rate:                 0.6302%            5599         0.0074%               8736
N Rate:                  72.0298%          639985         0.6044%             709655

What does an N rate of 72% mean in this context? The reference has 0 bases that are N. There are 20,000 out of the 1 million reads that contain an N. The N Rate percent bases of 0.6% seems high compared to 20,000 reads with 1 or 2 Ns, but closer to what I think I see than the 72% N for reads.

[SNPsaurus]

Yeah - I have but from what I can tell it maxes out at 6 reports unless maxsites is increased. I am wondering if there is a setting that avoids maxsites and reports everything above some score.

You might try the align2.BBMapPacBioSkimmer mapper with ambig=all and expectedsites= some high number. Not exactly what you were asking but I get dozens of hits with that.

[darthsequencer]

Have you tried ambig=all?

Yeah - I have but from what I can tell it maxes out at 6 reports unless maxsites is increased. I am wondering if there is a setting that avoids maxsites and reports everything above some score.

[GenoMax]

Have you tried ambig=all?

[darthsequencer]

Hi Brian - What are the right flags to set if I want all of the top scoring mappings for paired end reads?

Thanks

[kimng]

Thanks for the input but same issue using sam=1.3, I think Geno's comment on something he intended to do is on the mark.

[HESmith]

You can try the reformat.sh command per @GenoMax but with 'sam=1.3' flag. That worked for me with a different variant caller (FreeBayes).

[kimng]

Thanks for the info didn't realise that was the site for tickets so appreciate it, I'll create a ticket there.

[GenoMax]

It was worth a try.

Based on the `TODO` tag I see perhaps this is something @Brian intends to work on. Unfortunately he has not been participating in forums of late so there is no guarantee as to when this question may be addressed. You could try creating a ticket at BBMap SF repository for this question.

[kimng]

Appreciate the reply but unfortunately it leads to the same error:

java -ea -Xmx200m -cp /home/ssi.ad/kimn/.conda/envs/env_kim/opt/bbmap-37.90/current/ jgi.ReformatReads in=minimap.sam out=new.bam sam=1.4
Executing jgi.ReformatReads [in=minimap.sam, out=new.bam, sam=1.4]

Input is being processed as unpaired
java.lang.AssertionError: TODO: Encountered a read with 'M' in cigar string but no MD tag.
java.lang.AssertionError: TODO: Encountered a read with 'M' in cigar string but no MD tag.
at stream.SamLine.toShortMatch(SamLine.java:1200)
at stream.SamLine.toRead(SamLine.java:1972)
at stream.SamLine.toRead(SamLine.java:1832)
at stream.SamReadInputStream.toReadList(SamReadInputStream.java:118)
at stream.SamReadInputStream.fillBuffer(SamReadInputStream.java:89)
at stream.SamReadInputStream.hasMore(SamReadInputStream.java:53)
at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:664)
at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:653)