A program to extract the reads and modify the seq ID by adding weight

[bambus]

Hi everyone,

I have a problem in executing the perl script (found online) is given below, a script t0 compare 2 files

1) a file with seq IDs and its weight
2) a file with seq IDs and the sequences.

I modified the original script a bit and tried to use the code with my data,but it neither prints out the output nor gives out any errors and further I want to add the weights in the file 1 to the sequence ID after comparing and extracting the respective reads.

Input files and the script are attached.

expected output:-

>comp10003_c0_seq1 len=166 path=[748:0-22 1004:23-46 2527:47-165]_weight=41
AAGTAGCCTATGCGCTACAGTAAGAAAGACAGGTGAAAAAATGGAAGTAAAACAATTAGA
TGACTACTTTGGATATACAGAAAAGGGCAGTTCCTTAGAGGGGGAATTACGAGCAGGACT
AACGACATTCTTGACAATGGCGTACATTCTGTTTGTGAACCCAGAC


Could anyone please help me out.

Thank you in advance.

[westerman]

Your script is pulling in the sample_IDs with the '>' attached as well as the count. It then pulls in the sample_reads without the '>' attached. The program thus can not match up sample_IDs with sample_reads. So there are two problems here -- (1) you are not saving the counts and (2) you can not match up IDs.

The solution is to re-write the part where you have

$ids{$_} += 1;

Let us know you want more of a hint than that.

[bambus]

Does it mean that I have to create a hash of Ids or?

[westerman]

Yes, create the hash of IDs. You need to do two things:

1) Remove the '>'
2) Split out the counts from the read name and save the counts as the values in your hash.

[bambus]

Can you please help me how to proceed further to fulfill the steps you mentioned as I am not a very good programmer

[westerman]

The best way to become a better program is to experiment with your programs. :-)

That said, I would change the line:

$ids{$_} += 1;

To

my ($id, $count) = $_ =~ /^>*(\S+)\s+(\d+)/;
$ids{$id} = $count;

Note: I did not test the above. Basically you are taking the input line and looking for:
1) '>' (optional)
2) Characters (the id)
3) Whitespace
4) Digits (the count)
And then putting the id and count into your %ids hash