freebayes

[seq-seeker]

Hi,
I am using FreeBayes for SNP calling. When I input my sequences Freebayes runs fine until it hits a part of the sequence with a lot of NNNNs. I get the following error (I edited out a few Ns for this post):

Exception: Cannot read past the end of the alignment's sequence.
CTGGCAGCCTCTGGTTATCTTTAGTTTCTTCACTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN\NNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGGATCGAAACGAAACAGCCGATTGTTGTTTTCTTTATCGCAAGGATGATGAAGAAACTTTGGGAGAGAAACAAGTGAAGCCCGTTGGTCTAGCAAGTGATTGTAAAATG
ATCAAGACCCCACAAGGGAAAACAATCCTTAAAGCAGACTTGAGATCGATCATACC\GCAAGTGATTGTAAAATGT
Chr1:32635
Aborted

Here is the input I used:

freebayes -f reference.fa sorted.bam > sorted.vcf

I ran a trial with a truncated data set of just the first 100 lines of input, which ran fine and produced the expected out file in vcf format.

Does anyone have an idea how to handle this?
Thanks.

[AdrianP]

I have NNNN in my sequences and it runs just fine.

Is that a "\" i see in your sequence?

[seq-seeker]

Adrian,
I checked the \. They are not in the sequences and must have been introduced when I shortened the sequence while copying the error message into the window.

[AdrianP]

and it is talking about alignment, so I believe the error relates to the .bam file?