[GenoMax]

Try this (I am assuming that your variable expressions are correct). The log file and the redirect should be at the end of the command.

for x in *_R1_001.fastq;do your_bbmerge_command_along_with_options >bbmerge\/${x%_*-*_L001_R1_001.*}_bbmerge_log.txt 2>&1;done

[shimingt]

Log File

Hello,

I am a novice with command prompt. I can't seem to get a log file.

This is my command prompt:

for x in *_R1_001.fastq;do echo bbmerge.sh -Xmx20g in1=$x in2=${x%_R1_001.*}_R2_001.fastq out=bbmerge\/${x%_*-*_R1_001.*}_R1R2_bbmerge.fastq>bbmerge\/${x%_*-*_L001_R1_001.*}_bbmerge_log.txt 2>&1 outu1=outu1\/$x outu2=outu2\/${x%_R1_001.*}_R2_001.fastq >> bbmerge.sh;done

Am I doing something wrong here?

There are log files but they are all empty?

[GenoMax]

Hello there! Is there a way we could generate a stats or log file with bbmerge?

Stats are automatically generated with each run of BBMerge. They look something like this

Pairs:                  2879431
Joined:                 2052925         71.296%
Ambiguous:              810015          28.131%
No Solution:            16491           0.573%
Too Short:              0               0.000%

Avg Insert:             396.7
Standard Deviation:     98.1
Mode:                   415

Insert range:           35 - 591
90th percentile:        524
75th percentile:        469
50th percentile:        402
25th percentile:        332
10th percentile:        262

You can capture STDOUT/STDERR with standard bash conventions to a file (2>&1) to get the log info.

[shimingt]

Hello there! Is there a way we could generate a stats or log file with bbmerge?

[lcmb]

Thank you!

[Brian Bushnell]

You can postfilter it afterward:

reformat.sh in=reads.fq out=filtered.fq minlength=202 maxlength=202

But, bear in mind that you may be losing important data by doing so. For example, there could be a whole bunch of sequences that are 199bp long for some real biological reason (rather than problems with library prep). So, just be cautious.

[lcmb]

Thank you both for your help! Do you have any suggestions on how to set optional parameters to ensure that my merged file only contains sequences of my intended/designed insert size?

[lcmb]

I am using:

bbmerge.sh in1=<read1> in2=<read2> out=<mergedreads> outu1=<unmerged1> outu2=<unmerged2> mismatches=0

[Brian Bushnell]

In this case it looks like BBMerge's output is correct... as GenoMax said, you have adapter sequences indicating short inserts. Specifically, read1's first 126 bases exactly match BBMerge's output, and subsequently there is:
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATGTCGTATGCCGTCTTCTGCTTG
...a known Illumina adapter sequence, followed by AAAAAA which is common after the Illumina machine runs of the end of the adapter sequence and has no signal.

No matter what you expect/design your insert size to be, shorter fragments will almost always be present.

[GenoMax]

Can you provide the exact command you are using? Your reads do have truseq adapters in them so the inserts may be smaller than you expected.

@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 1:N:0:TGACCAAT+ATAGAGGC
TCTGCCGTCATCGACTTCGAAGGTTCGAATCCTTCCCCTCTAACCACGGCCGAAATTCAATACCCGGATCAAGCTCAATTCGGGTCGAGGTCGGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGA[COLOR="Red"]GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATGTCGTATGCCGTCTTCTGCTTG[/COLOR]AAAAAAAATAAGTGGTGCGAAGAGAGCCTGTGGCCAACCTCATATGCGTGGAGATGTCTCG

[lcmb]

Truncated merges

Hello,

I have noticed that some of my merged sequences, after using BBMerge, are truncated. My R1/R2 input sequences are 251 bp long (paired-end 250 bp sequencing). The overlap/insert, which I expect to be merged from the R1/R2 files, is 202 bp long. Although many of my merged sequences are the expected 202 bp long, a handful are much shorter.

The only optional parameter I have changed is setting mismatches=0, as I do not want any discrepancies in the overlap.

Here is an example:

Raw Data: R1 and R2 files (fastq.gz)
R1 File: 251 nucleotides
@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 1:N:0:TGACCAAT+ATAGAGGC
TCTGCCGTCATCGACTTCGAAGGTTCGAATCCTTCCCCTCTAACCACGGCCGAAATTCAATACCCGGATCAAGCTCAATTCGGGTCGAGGTCGGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATGTCGTATGCCGTCTTCTGCTTGAAAAAAAATAAGTGGTGCGAAGAGAGCCTGTGGCCAACCTCATATGCGTGGAGATGTCTCG

R2: 251 nucleotides
@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 2:N:0:TGACCAAT+ATAGAGGC
CGGAGCCTATGGAAAAACGCCAGCAACGCGGCCCGACCTCGACCCGAATTGAGCTTGATCCGGGTATTGAATTTCGGCCGTGGTTAGAGGGGAAGGATTCGAACCTTCGAAGTCGATGACGGCAGAAGATCGGAAGAGCGTCGTGTAGGGAAGGAGTGGGCCTAGATGTGTGGGTCGCGGTGGTGGCCGGATCGATGAAGAAAGTCTGGTGCTGGTGTGTGTGACGCCAGGGCGTCAGCAGTGGTGATGTG

------------------------------------------------------------------------------------------------------------------------------------------------------

BBMerge Output: 126 nucleotides
@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 1:N:0:TGACCAAT+ATAGAGGC
TCTGCCGTCATCGACTTCGAAGGTTCGAATCCTTCCCCTCTAACCACGGCCGAAATTCAATACCCGGATCAAGCTCAATTCGGGTCGAGGTCGGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCG

------------------------------------------------------------------------------------------------------------------------------------------------------

Thank you for your help!

[Brian Bushnell]

Hi Luc,

Both of them apply to both reads. Let's say that you have 100bp reads in and you want to trim them to 70bp by trimming the right end. You can do that in two ways - either "ftr2=30" which trims the last 30bp, or "ftr=69" which trims all bases after position 69 (zero-based). The reason both options are present is because they behave differently when reads have variable lengths.

[luc]

What is the difference/ between ftr and ftr2?
Does ftr apply to the forward read and ftr2 to the reverse read?

Thanks in advance!

forcetrimright=0 (ftr) If nonzero, trim right bases of the read
after this position (exclusive, 0-based).
forcetrimright2=0 (ftr2) If positive, trim this many bases on the right end.

[rc630]

Hmmm, that's very strange. They look fine to me. For some reason it thinks you set the max number of reads to zero. Can you try adding the flag "reads=-1"?

Thank you very much, it worked fine with the flag added

[Brian Bushnell]

Hmmm, that's very strange. They look fine to me. For some reason it thinks you set the max number of reads to zero. Can you try adding the flag "reads=-1"?