[sanwen]

You would use dog, not dog.fa. It adds the .fa for you when it search.es

if i use "dog", it shows that "
could not find Bowtie index files dog.*"

i use "dog.fa" to build the index, so i seem that use "dog.fa" as basename is OK, but it fail.

[sanwen]

Can you verify that the FASTQ file is correctly formatted? The fact that TopHat is choosing a seed length of 101bp tells me something's up with that file. The seed length ought to be 25 for 50bp reads or longer. TopHat's FASTQ parser occasionally screws up when FASTQ records are incorrectly formatted or when the read and/or quality sequences span more than one line in the file. We plan to replace the parser in an upcoming version to make it more robust to this kind of thing.

how to set seed length in tophat? i use -l but it fail to work.

[wanfahmi]

Hey,

I got a problem running my rna-seq data. All software were updated to current version. Here is the error;

[2012-11-15 15:27:42] Beginning TopHat run (v2.0.4)
-----------------------------------------------
[2012-11-15 15:27:42] Checking for Bowtie
Bowtie version: 2.0.0.7
[2012-11-15 15:27:42] Checking for Samtools
Samtools version: 0.1.18.0
[2012-11-15 15:27:42] Checking for Bowtie index files
[2012-11-15 15:27:42] Checking for reference FASTA file
[2012-11-15 15:27:42] Generating SAM header for genome
format: fastq
quality scale: solexa33 (reads generated with GA pipeline version < 1.3)
[2012-11-15 15:27:46] Reading known junctions from GTF file
[2012-11-15 15:28:08] Preparing reads
[FAILED]
Error retrieving prep_reads info.

My command was ;

tophat --solexa-quals -p 2 -G genes.gtf -o S1_R1_thout genome S1_R1.fq S1_R2.fq

Below is my fastq file;

@XXXXXX-HISEQ:2151D4GACXX:4:1101:1414:2232 1:N:0:TGACCA
CCATGCAGAAGGGTACAGTTACATTAAGAACTGAAGTCTTTTAAAAAGCTTTAAACATTCTTTCTTGAACCAAAACATTCGACAAAAGATGCACATGAAA
+
CCCFFFFFGGHHG?FHJEFCHGHIJJJIGJJJIJJCCGIIJIHIJJJIGIIIGIIJJIGIJIJGGIIJGGGIJIJEEEHGAEDB>>CEDDDDDCCCDCDC




Please advice. Thank you

[wanfahmi]

[2012-11-27 11:14:53] Beginning TopHat run (v2.0.4)
-----------------------------------------------
[2012-11-27 11:14:53] Checking for Bowtie
Bowtie version: 2.0.0.7
[2012-11-27 11:14:53] Checking for Samtools
Samtools version: 0.1.18.0
[2012-11-27 11:14:53] Checking for Bowtie index files
[2012-11-27 11:14:53] Checking for reference FASTA file
[2012-11-27 11:14:53] Generating SAM header for genome
format: fastq
quality scale: solexa33 (reads generated with GA pipeline version < 1.3)
[2012-11-27 11:14:58] Reading known junctions from GTF file
[2012-11-27 11:15:20] Preparing reads
[FAILED]
Error running 'prep_reads'
Error: qual length (162) differs from seq length (100) for fastq record !

I try it again, run on with a same command, but appeared with different error.

[carmeyeii]

For me, it was trying to use too small anchor lengths in the TopHat-Fusion mode.

It seems it wants an integer greater than or equal to 10.


Carmen

[dhatziioanou]

Hello, I know this is a pretty old thread but I got the same problem now in 2015 and since I don't have any good quality data to use instead I had a little dig. The index error is a python error caused by the fasq data format having issues, in my case at least I know my index is fine.
My data was already perfectly paired by I passed it through pairfq-lite version 0.14.3 anyway, I got all the data back in two new paired files (the unpaired files were 0 bytes) and now that I'm running htop again it seems to be working, at least its passing that stage and reading the files

Before:
[2015-10-02 10:46:41] Beginning TopHat run (v2.0.9)
-----------------------------------------------
[2015-10-02 10:46:41] Checking for Bowtie
Bowtie version: 2.1.0.0
[2015-10-02 10:46:41] Checking for Samtools
Samtools version: 0.1.19.0
[2015-10-02 10:46:41] Checking for Bowtie index files (genome)..
[2015-10-02 10:46:41] Checking for reference FASTA file
[2015-10-02 10:46:41] Generating SAM header for GRCm38.p4.genome
Traceback (most recent call last):
File "/usr/bin/tophat", line 4072, in <module>
sys.exit(main())
File "/usr/bin/tophat", line 3926, in main
params.read_params = check_reads_format(params, reads_list)
File "/usr/bin/tophat", line 1832, in check_reads_format
freader=FastxReader(zf.file, params.read_params.color, zf.fname)
File "/usr/bin/tophat", line 1577, in __init__
while hlines>0 and self.lastline[0] not in "@>" :
IndexError: string index out of range

After:
[2015-10-02 12:14:34] Beginning TopHat run (v2.0.9)
-----------------------------------------------
[2015-10-02 12:14:34] Checking for Bowtie
Bowtie version: 2.1.0.0
[2015-10-02 12:14:34] Checking for Samtools
Samtools version: 0.1.19.0
[2015-10-02 12:14:34] Checking for Bowtie index files (genome)..
[2015-10-02 12:14:34] Checking for reference FASTA file
[2015-10-02 12:14:34] Generating SAM header for GRCm38.p4.genome
format: fastq
quality scale: phred33 (default)
[2015-10-02 12:14:36] Reading known junctions from GTF file
[2015-10-02 12:14:53] Preparing reads