Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • sanwen
    Member
    • May 2010
    • 12

    #31
    Originally posted by raela View Post
    You would use dog, not dog.fa. It adds the .fa for you when it search.es
    if i use "dog", it shows that "
    could not find Bowtie index files dog.*"

    i use "dog.fa" to build the index, so i seem that use "dog.fa" as basename is OK, but it fail.

    Comment

    • sanwen
      Member
      • May 2010
      • 12

      #32
      Originally posted by Cole Trapnell View Post
      Can you verify that the FASTQ file is correctly formatted? The fact that TopHat is choosing a seed length of 101bp tells me something's up with that file. The seed length ought to be 25 for 50bp reads or longer. TopHat's FASTQ parser occasionally screws up when FASTQ records are incorrectly formatted or when the read and/or quality sequences span more than one line in the file. We plan to replace the parser in an upcoming version to make it more robust to this kind of thing.
      how to set seed length in tophat? i use -l but it fail to work.

      Comment

      • wanfahmi
        Member
        • Apr 2008
        • 34

        #33
        Hey,

        I got a problem running my rna-seq data. All software were updated to current version. Here is the error;

        [2012-11-15 15:27:42] Beginning TopHat run (v2.0.4)
        -----------------------------------------------
        [2012-11-15 15:27:42] Checking for Bowtie
        Bowtie version: 2.0.0.7
        [2012-11-15 15:27:42] Checking for Samtools
        Samtools version: 0.1.18.0
        [2012-11-15 15:27:42] Checking for Bowtie index files
        [2012-11-15 15:27:42] Checking for reference FASTA file
        [2012-11-15 15:27:42] Generating SAM header for genome
        format: fastq
        quality scale: solexa33 (reads generated with GA pipeline version < 1.3)
        [2012-11-15 15:27:46] Reading known junctions from GTF file
        [2012-11-15 15:28:08] Preparing reads
        [FAILED]
        Error retrieving prep_reads info.

        My command was ;

        tophat --solexa-quals -p 2 -G genes.gtf -o S1_R1_thout genome S1_R1.fq S1_R2.fq

        Below is my fastq file;

        @XXXXXX-HISEQ:2151D4GACXX:4:1101:1414:2232 1:N:0:TGACCA
        CCATGCAGAAGGGTACAGTTACATTAAGAACTGAAGTCTTTTAAAAAGCTTTAAACATTCTTTCTTGAACCAAAACATTCGACAAAAGATGCACATGAAA
        +
        CCCFFFFFGGHHG?FHJEFCHGHIJJJIGJJJIJJCCGIIJIHIJJJIGIIIGIIJJIGIJIJGGIIJGGGIJIJEEEHGAEDB>>CEDDDDDCCCDCDC




        Please advice. Thank you

        Comment

        • wanfahmi
          Member
          • Apr 2008
          • 34

          #34
          [2012-11-27 11:14:53] Beginning TopHat run (v2.0.4)
          -----------------------------------------------
          [2012-11-27 11:14:53] Checking for Bowtie
          Bowtie version: 2.0.0.7
          [2012-11-27 11:14:53] Checking for Samtools
          Samtools version: 0.1.18.0
          [2012-11-27 11:14:53] Checking for Bowtie index files
          [2012-11-27 11:14:53] Checking for reference FASTA file
          [2012-11-27 11:14:53] Generating SAM header for genome
          format: fastq
          quality scale: solexa33 (reads generated with GA pipeline version < 1.3)
          [2012-11-27 11:14:58] Reading known junctions from GTF file
          [2012-11-27 11:15:20] Preparing reads
          [FAILED]
          Error running 'prep_reads'
          Error: qual length (162) differs from seq length (100) for fastq record !
          I try it again, run on with a same command, but appeared with different error.

          Comment

          • carmeyeii
            Senior Member
            • Mar 2011
            • 137

            #35
            For me, it was trying to use too small anchor lengths in the TopHat-Fusion mode.

            It seems it wants an integer greater than or equal to 10.


            Carmen

            Comment

            • dhatziioanou
              Junior Member
              • Aug 2012
              • 8

              #36
              Hello, I know this is a pretty old thread but I got the same problem now in 2015 and since I don't have any good quality data to use instead I had a little dig. The index error is a python error caused by the fasq data format having issues, in my case at least I know my index is fine.
              My data was already perfectly paired by I passed it through pairfq-lite version 0.14.3 anyway, I got all the data back in two new paired files (the unpaired files were 0 bytes) and now that I'm running htop again it seems to be working, at least its passing that stage and reading the files

              Before:
              [2015-10-02 10:46:41] Beginning TopHat run (v2.0.9)
              -----------------------------------------------
              [2015-10-02 10:46:41] Checking for Bowtie
              Bowtie version: 2.1.0.0
              [2015-10-02 10:46:41] Checking for Samtools
              Samtools version: 0.1.19.0
              [2015-10-02 10:46:41] Checking for Bowtie index files (genome)..
              [2015-10-02 10:46:41] Checking for reference FASTA file
              [2015-10-02 10:46:41] Generating SAM header for GRCm38.p4.genome
              Traceback (most recent call last):
              File "/usr/bin/tophat", line 4072, in <module>
              sys.exit(main())
              File "/usr/bin/tophat", line 3926, in main
              params.read_params = check_reads_format(params, reads_list)
              File "/usr/bin/tophat", line 1832, in check_reads_format
              freader=FastxReader(zf.file, params.read_params.color, zf.fname)
              File "/usr/bin/tophat", line 1577, in __init__
              while hlines>0 and self.lastline[0] not in "@>" :
              IndexError: string index out of range

              After:
              [2015-10-02 12:14:34] Beginning TopHat run (v2.0.9)
              -----------------------------------------------
              [2015-10-02 12:14:34] Checking for Bowtie
              Bowtie version: 2.1.0.0
              [2015-10-02 12:14:34] Checking for Samtools
              Samtools version: 0.1.19.0
              [2015-10-02 12:14:34] Checking for Bowtie index files (genome)..
              [2015-10-02 12:14:34] Checking for reference FASTA file
              [2015-10-02 12:14:34] Generating SAM header for GRCm38.p4.genome
              format: fastq
              quality scale: phred33 (default)
              [2015-10-02 12:14:36] Reading known junctions from GTF file
              [2015-10-02 12:14:53] Preparing reads

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, Yesterday, 07:41 AM
              0 responses
              11 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              25 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              38 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              25 views
              0 reactions
              Last Post SEQadmin2  
              Working...