Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • rcorbett
    Member
    • Sep 2009
    • 29

    #16
    I am getting the same error:
    This is with version tophat-1.0.13. Has anyone coded a fix for this?

    @2065
    AGGCCGCTCCGGGCGCTGGACGTTGGGCTCCTGGCGAACCTCTCGGCGCTGGAGACTGGATATAACACAAC
    +SOLEXA3_1:1:1:22:173/2
    EDHEGHHCDHHGHHHHHCG/HHHHGEDHH=HHHGGHF<?HHHEGHDCHHADB#6@=#8AAG:@@E=1#@>#
    Saw ASCII character 10 but expected 33-based Phred qual.
    terminate called after throwing an instance of 'int'
    Aborted

    Comment

    • rcorbett
      Member
      • Sep 2009
      • 29

      #17
      I tried a workaround of changing all the "." characters in the sequence to "N" with awk:

      awk '{if ( (NR-2)%4==0) {gsub(/\./,"N",$0); print $0} else { print $0}}'

      Which gets me through prep_reads without any errors. Can anyone comment on if this is a safe workaround?

      Comment

      • bzhang
        Member
        • Apr 2010
        • 10

        #18
        Originally posted by rcorbett View Post
        I tried a workaround of changing all the "." characters in the sequence to "N" with awk:

        awk '{if ( (NR-2)%4==0) {gsub(/\./,"N",$0); print $0} else { print $0}}'

        Which gets me through prep_reads without any errors. Can anyone comment on if this is a safe workaround?
        I did the same conversion and was able to run the downstream analysis with cufflinks and the result seems to be fine. I think this is a safe workaround as 'N' is a legitimate character in the fasta sequence and I assume the alignment software (bowtie) treats it intelligently.

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #19
          I've added [ code ] tags round your FASTQ example for clarity - otherwise the forum messes things up.
          Originally posted by rcorbett View Post
          I am getting the same error:
          This is with version tophat-1.0.13. Has anyone coded a fix for this?

          Code:
          @2065
          AGGCCGCTCCGGGCGCTGGACGTTGGGCTCCTGGCGAACCTCTCGGCGCTGGAGACTGGATATAACACAAC
          +SOLEXA3_1:1:1:22:173/2
          EDHEGHHCDHHGHHHHHCG/HHHHGEDHH=HHHGGHF<?HHHEGHDCHHADB#6@=#8AAG:@@E=1#@>#
          Saw ASCII character 10 but expected 33-based Phred qual.
          terminate called after throwing an instance of 'int'
          Aborted
          The (optional repeated) identifier on the + line doesn't match the (mandatory) identifier on the @ line. Assuming nothing went wrong in the cut and paste into the forum, it looks like something is very wrong with your FASTQ file. This may be what is upsetting tophat.

          Comment

          • clariet
            Member
            • Mar 2010
            • 18

            #20
            Hi, Cole_Trapnell

            Does current version of Tophat support SOLiD data? Thanks

            Clariet

            Originally posted by Cole Trapnell View Post
            Thanks for the heads up. We'll add the bug to our tracker and address it in the next release. Others are likely to have this problem.

            Comment

            • Cole Trapnell
              Senior Member
              • Nov 2008
              • 213

              #21
              Originally posted by maubp View Post
              I've added [ code ] tags round your FASTQ example for clarity - otherwise the forum messes things up.

              The (optional repeated) identifier on the + line doesn't match the (mandatory) identifier on the @ line. Assuming nothing went wrong in the cut and paste into the forum, it looks like something is very wrong with your FASTQ file. This may be what is upsetting tophat.

              Actually, the mismatch between the "@" and "+" names should be fine, at least within TopHat. In fact, the program exploits this feature of FASTQ to make analyzing paired and long reads much easier. One of the first things TopHat does is "rename" the user's reads with increasing integer IDs, moving their true names from the "@" field down to the "+" field and rewriting the FASTQ files to a temporary file. Mate pairs from the same fragment get the same ID, making intermediate results for them them much easier to match back up later on.

              Comment

              • Cole Trapnell
                Senior Member
                • Nov 2008
                • 213

                #22
                Originally posted by clariet View Post
                Hi, Cole_Trapnell

                Does current version of Tophat support SOLiD data? Thanks

                Clariet
                Currently, no.

                Comment

                • clariet
                  Member
                  • Mar 2010
                  • 18

                  #23
                  Thank you. Are you planning to add this sometime soon? My colleague has very good comments on TopHat and I am very much looking forward to using this tool for SOLiD data, which I have access only. Bowtie, as far as I know, supports SOLiD.

                  Originally posted by Cole Trapnell View Post
                  Currently, no.

                  Comment

                  • RSK
                    Junior Member
                    • Jun 2009
                    • 9

                    #24
                    Empty (almost) junctions.bed file...

                    I have a related question.
                    I mapped Illumina 100nt reads using TopHat in default mode.
                    The resulting junctions.bed has only a single line, "track name=junctions description="TopHat junctions"."
                    When I used the resulting accepted_hits.sam file to identify transcripts using Cufflinks, the resulting transcripts.gtf has about 190,000 transcripts. But, all the transcripts have only one exon!
                    All these things together makes me wonder if there was a problem with mapping across intronic regions in the TopHat/Bowtie stage, with these data.

                    Please let me know if anyone has any idea on how to deal with this issue. Also please let me know if my description needs any clarifications.

                    Thanks!
                    -RSK

                    Comment

                    • maximilianh
                      Member
                      • Oct 2009
                      • 15

                      #25
                      Same here

                      Originally posted by bzhang View Post
                      I did the same conversion and was able to run the downstream analysis with cufflinks and the result seems to be fine. I think this is a safe workaround as 'N' is a legitimate character in the fasta sequence and I assume the alignment software (bowtie) treats it intelligently.
                      I have used "maq sol2sanger" to convert my fastq file.

                      I had the same problem and applied that little gawk script (thanks guys, really saved me wasting hours).

                      And Cole: I am using tophat 1.0.14.

                      Comment

                      • thinkRNA
                        Member
                        • Jan 2010
                        • 94

                        #26
                        Originally posted by maximilianh View Post
                        I have used "maq sol2sanger" to convert my fastq file.

                        I had the same problem and applied that little gawk script (thanks guys, really saved me wasting hours).

                        And Cole: I am using tophat 1.0.14.
                        Where did you get version 1.0.14? I thought the latest that was out was TopHat 1.0.13 (BETA) release 2/5/2010

                        Comment

                        • maximilianh
                          Member
                          • Oct 2009
                          • 15

                          #27
                          TopHat 1.0.14

                          Originally posted by thinkRNA View Post
                          Where did you get version 1.0.14? I thought the latest that was out was TopHat 1.0.13 (BETA) release 2/5/2010
                          From here: http://tophat.cbcb.umd.edu/index.html

                          Comment

                          • maximilianh
                            Member
                            • Oct 2009
                            • 15

                            #28
                            Originally posted by shurjo View Post
                            If this is Illumina data, were your reads processed with pipeline v1.3 or later? If so, you have to include the --solexa-quals option in your TopHat run.
                            I've had the same problem when pre-processed the illumina file first with maq sol2sanger. I am using tophat 1.4 now and AM NOT PREPROCESSING anymore and it works!! Just use the .txt file

                            Max

                            Comment

                            • sanwen
                              Member
                              • May 2010
                              • 12

                              #29
                              I did not understand what this paragraph mean in the Manual, i am not a native english speaker.
                              "Arguments:
                              <ebwt_base> The basename of the index to be searched. The basename is the name of any of the five index files up to but not including the first period. bowtie first looks in the current directory for the index files, then looks in the indexes subdirectory under the directory where the currently-running bowtie executable is located, then looks in the directory specified in the BOWTIE_INDEXES environment variable. "
                              what does this paragraph? For example, i have bowtie index (dog.fa, dog.fa.1.ebwt, dog.fa.2.ebwt and so on) in director /home/index, when i try to run the software, i type "tophat -r 200 /home/index/dog.fa test.fq
                              but it always show :
                              checking for Bowtie index files
                              checking for reference FASTA file
                              Warning:Could not find FASTA file /home/indexdog.fa.fa
                              Reconstituting reference FASTA file from Bowtie index

                              What is the problem?

                              Comment

                              • raela
                                Member
                                • Apr 2010
                                • 39

                                #30
                                You would use dog, not dog.fa. It adds the .fa for you when it search.es

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                20 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                34 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                21 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...