Does anyone have a trick or script to convert collapsed reads back to raw fasta reads? I need them in raw fasta to be able to map with bowtie.
a perl script maybe will do it?
a perl script maybe will do it?
-
-
What are collapsed reads? -
>1-1377297
tgtaaacatcctcgactggaagct
>2-783040
tttggcaatggtagaactcacact
>3-461345
tagcttatcagactgatgttgacaComment
-
This looks like fasta to me, I'm still not sure what "collapsed reads" mean.Originally posted by Palgrave View Post
You can add "-f" to your bowtie command for alignment of reads in fasta format.Comment
-
I'm guessing that what you have are miRNA reads, with all identical sequences "collapsed" and your definition line means >[miRNA-id]-[counts].Originally posted by Palgrave View Post
I'm also guessing that you are asking how to create a file that contains 1,377,297 copies of miRNA-1, 783,040 copies of miRNA-2, etc.
Is that what you want to do? If it is, please don't. It would be a waste of time and cpu cycles to have Bowtie map exactly the same sequence 1,377,297 times. Map each unique sequence just once and then account for sequence abundance in your downstream analysis.Comment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM
Comment