Does anyone have a trick or script to convert collapsed reads back to raw fasta reads? I need them in raw fasta to be able to map with bowtie.
a perl script maybe will do it?
a perl script maybe will do it?
-
-
What are collapsed reads? -
>1-1377297
tgtaaacatcctcgactggaagct
>2-783040
tttggcaatggtagaactcacact
>3-461345
tagcttatcagactgatgttgacaComment
-
This looks like fasta to me, I'm still not sure what "collapsed reads" mean.Originally posted by Palgrave View Post
You can add "-f" to your bowtie command for alignment of reads in fasta format.Comment
-
I'm guessing that what you have are miRNA reads, with all identical sequences "collapsed" and your definition line means >[miRNA-id]-[counts].Originally posted by Palgrave View Post
I'm also guessing that you are asking how to create a file that contains 1,377,297 copies of miRNA-1, 783,040 copies of miRNA-2, etc.
Is that what you want to do? If it is, please don't. It would be a waste of time and cpu cycles to have Bowtie map exactly the same sequence 1,377,297 times. Map each unique sequence just once and then account for sequence abundance in your downstream analysis.Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment