Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • carolW
    Senior Member
    • Apr 2013
    • 103

    #1

    raxml

    Hi,
    I don't know how the species' name should be in the phylip format for raxml. Even if there is no space in the name, I get the error msg

    ERROR: Problem reading number of species and sites

    I use either format below, I get this msg. How should the name appear?

    Look forward to your reply,

    Carol
    ---------------------------------------
    >1112142-1113254_NC_014152.1_Thermincola_potens_JR_chromosome,_complete_genome
    ATGCGCAGTTTGAAGGGGGTAATTTCCACATCTGCTCTGGAACTGGGGGTGGACTTGCCG
    GAACTGGA----GTTTTGCGTTTTGCTTCAACGGCTTCTGGCAGAGAGTAGG

    >1112142-1113254 NC_014152.1 Thermincola potens JR chromosome, complete genome
    ATGCGCAGTTTGAAGGGGGTAATTTCCACATCTGCTCTGGAACTGGGGGTGGACTTGCCG
    GAACTGGA----GTTTTGCGTTTTGCTTCAACGGCTTCTGGCAGAGAGTAGG
    >1109551-1110576 NC_014152.1 Thermincola potens JR chromosome, complete genome
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Phylip file format example for DNA is here: http://www.molecularevolution.org/re...ats/phylip_dna

    That said, RAXML manual says this about names:

    Prohibited Character(s) in taxon names are names that contain any form of whitespace character, like blanks, tabulators, and carriage returns, as well as one of the following prohibited characters: : or () or []
    Have you tried replacing the "." in GenBank ID's with something else?

    Comment

    • carolW
      Senior Member
      • Apr 2013
      • 103

      #3
      No, your comment is correct but I think - in genomic coordinates should be replaced.

      It seems that a name processing should be carried out for all species name which is an extra work. I don't know if it is the same for other phylogeny soft.

      Many thanks

      Carol

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Does not hurt to try replacing the "-" too.

        There are many interesting requirements for other phylogeny software packages (e.g. program truncating the names to first 8 characters so you need to make that part unique etc). RAXML claims that it will take any 256 characters but we shall see if you can get past this first step by doing the two replacements.

        Comment

        • carolW
          Senior Member
          • Apr 2013
          • 103

          #5
          yes, it does. I should also have replaced the space, carriage return between name and seq, add number of seq and length of seq on the first line, etc. it means that the fasta format of the seq should be processed to be used with raxml.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 10:35 AM
          0 responses
          7 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-06-2026, 07:41 AM
          0 responses
          25 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-03-2026, 10:13 AM
          0 responses
          45 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          48 views
          0 reactions
          Last Post SEQadmin2  
          Working...