Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mhadidi2002
    Member
    • Jun 2011
    • 24

    Removing duplicates from 16S RNA data

    Hello All,

    I would like to start a pipeline to analyse 16S RNA data, however I am not sure weather to include the step of removing duplicates or not. The aim of metagenomics is to compare different samples and see how the microbiota is different within samples of different conditions/time points.

    After aligning, each sequence will match a sequence from a database, which will be then mapped to a bacteria and assigned taxonomy. the aim is to find how microbial content changes within each sample. If I removed duplicates, each sequence will be represented once, then taxonomy to this organism will be assigned once! so I am losing data here, which is the content of unknown bacteria in a sample with quantity for each one.

    I am not sure if I am perceiving this right or not! I appreciate your comments.

    Regards,
    Bioinfguy
  • kmcarr
    Senior Member
    • May 2008
    • 1181

    #2
    Originally posted by mhadidi2002 View Post
    If I removed duplicates, each sequence will be represented once, then taxonomy to this organism will be assigned once! so I am losing data here, which is the content of unknown bacteria in a sample with quantity for each one.
    I think you just answered your own question. No, do not remove duplicates for 16S metagenomics studies.

    Comment

    • mhadidi2002
      Member
      • Jun 2011
      • 24

      #3
      Thanks Kmcarr for the reply. I am asking because in mothur pipeline they do remove duplicates, that's why I am confused. Do you know why they are doing such so?
      if you go to the link: http://www.mothur.org/wiki/MiSeq_SOP and searched by "unique.seqs" you will find it!

      Comment

      • kmcarr
        Senior Member
        • May 2008
        • 1181

        #4
        Originally posted by mhadidi2002 View Post
        Thanks Kmcarr for the reply. I am asking because in mothur pipeline they do remove duplicates, that's why I am confused. Do you know why they are doing such so?
        if you go to the link: http://www.mothur.org/wiki/MiSeq_SOP and searched by "unique.seqs" you will find it!
        The tutorial explains why they are doing it, for efficiency. They keep a single copy of each unique sequence so that you only have to align that sequence to your reference once. But notice that in this process you also create a file with the counts of each unique sequence in the original data set which is used later in the analysis so you have not lost that abundance data. A more apt name for this is "collapsing duplicates" as opposed to "removing duplicates".

        Comment

        • mhadidi2002
          Member
          • Jun 2011
          • 24

          #5
          But notice that in this process you also create a file with the counts of each unique sequence in the original data set which is used later in the analysis so you have not lost that abundance data.
          Fastx has a tool called fastq_collaper which output a fasta file like this:

          >1-934
          CCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGGAAGCCTGAA
          >2-915
          CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT

          This means that sequence no. 1 has 934 duplicates. when I use this to align against database, the aligner consider 1-934 to be the sequence ID, will not know that it has 934 duplicates. How can I use this in further analysis to keep the abundance?

          Comment

          • kmcarr
            Senior Member
            • May 2008
            • 1181

            #6
            Originally posted by mhadidi2002 View Post
            Fastx has a tool called fastq_collaper which output a fasta file like this:

            >1-934
            CCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGGAAGCCTGAA
            >2-915
            CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT

            This means that sequence no. 1 has 934 duplicates. when I use this to align against database, the aligner consider 1-934 to be the sequence ID, will not know that it has 934 duplicates. How can I use this in further analysis to keep the abundance?
            Are you using Mothur or are you using your own custom pipeline? If you are using your own then you will need to figure out a way to add the count information back into your analysis.

            Comment

            • mhadidi2002
              Member
              • Jun 2011
              • 24

              #7
              Originally posted by kmcarr View Post
              Are you using Mothur or are you using your own custom pipeline? If you are using your own then you will need to figure out a way to add the count information back into your analysis.
              I am using my custom pipeline. so you mean that if I used mothur pipeline, they keep this in consideration to the rest of pipeline, but if I am using my pipeline I have to write a script that do this.. cool. Thnaks for the help!

              Comment

              Latest Articles

              Collapse

              • GATTACAT
                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by GATTACAT
                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                07-01-2026, 11:43 AM
              • SEQadmin2
                Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by SEQadmin2


                I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                Here are nine questions we think about, in roughly the order they matter, before...
                06-18-2026, 07:11 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-02-2026, 11:08 AM
              0 responses
              26 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-30-2026, 05:37 AM
              0 responses
              24 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-26-2026, 11:10 AM
              0 responses
              24 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-17-2026, 06:09 AM
              0 responses
              55 views
              0 reactions
              Last Post SEQadmin2  
              Working...