Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • hollandorange
    Member
    • May 2010
    • 11

    sam flag 97 and 145

    Hello,

    After alignment, I got reads in the sam format with flag 97 and 145.
    flag 97:
    the read is paired in sequencing;
    strand of the mate reverse;
    the read is the first read in a pair;

    flag 145:
    the read is paired in sequencing;
    strand of the query;
    the read is the second read in a pair;

    These reads are not mapped in a proper pair but both query and mate are mapped. how to explain this? could you give me an example?

    Thanks
    Yanju
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    They might be mapping to different contigs? What are the full SAM lines for these two reads?

    Comment

    • hollandorange
      Member
      • May 2010
      • 11

      #3
      The reads are looking like the following. I only have one reference sequence.

      ENST000004134650_104_988_445_609_200# 97 ENSG00000141510 13261 37 36M = 14182 957 CGGTCAACCGTTTTGTAGAACAACTCCCGTCCCCTC 22222
      2222222222222222222222222222222 XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36

      ENST000004134650_104_988_445_609_200# 145 ENSG00000141510 14182 37 36M = 13261 -957 GCGGCCACATCCTCGACGACCACGTCCCCGGTGCCC 22222
      2222222222222222222222222222222 XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36

      Comment

      • hollandorange
        Member
        • May 2010
        • 11

        #4
        anybody help?

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          First read, 97 == 1 + 32 + 64 == 0x1 + 0x20 + 0x40

          0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
          0x0020 strand of the mate (0 for forward; 1 for reverse strand)
          0x0040 the read is the first read in a pair

          Second read, 145 == 1 + 16 + 128 == 0x1 + 0x10 + 0x80

          0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
          0x0010 strand of the query (0 for forward; 1 for reverse strand)
          0x0080 the read is the second read in a pair

          So first read (flag 97) is on the forward strand (since it does not have 0x10 set), second read (flag 145) is on the reverse strand (since it does have 0x10 set).
          Last edited by maubp; 05-14-2010, 01:31 PM. Reason: corrected forward/reverse as discussed in next two posts

          Comment

          • hollandorange
            Member
            • May 2010
            • 11

            #6
            I think it is the other way round:
            the first read (97) is on the forward strand, since the strand of the mate is 1 (reverse);
            the second read is on the reverse strand.

            and in both cases (97,145)
            0x0002 the read is mapped in a proper pair =0
            0x0004 the query sequence itself is unmapped=0 (0 means it is mapped ???)
            0x0008 the mate is unmapped=0 (0 means it is mapped ???)
            This means both of them are mapped? but not proper?
            Last edited by hollandorange; 05-14-2010, 01:18 PM.

            Comment

            • maubp
              Peter (Biopython etc)
              • Jul 2009
              • 1544

              #7
              Originally posted by hollandorange View Post
              I think it is the other way round:
              the first read (97) is on the forward strand, since the strand of the mate is 1 (reverse);
              the second read is on the reverse strand.
              Yes - I had it right the first time, but flipped in back in a hurry before leaving the computer

              Comment

              • hollandorange
                Member
                • May 2010
                • 11

                #8
                I had a detail look at the samtool manu. I found, for these reads, the inferred insert size is very large like 957. but in my setting, the insertsize_mean is 200 and std is 20.

                is it the reason that they are mapped, but their mapped position is too far away and then samtool report not proper mapped?

                Comment

                • nilshomer
                  Nils Homer
                  • Nov 2008
                  • 1283

                  #9
                  Originally posted by hollandorange View Post
                  I had a detail look at the samtool manu. I found, for these reads, the inferred insert size is very large like 957. but in my setting, the insertsize_mean is 200 and std is 20.

                  is it the reason that they are mapped, but their mapped position is too far away and then samtool report not proper mapped?
                  The flags are set by the aligner, not samtools, so checkout the aligner's documentation. Check out the following to help you digest individual tags:


                  Also, you can use the "-X" option in "samtools view" to convert the flag field to a string format.

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM
                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM
                  • SEQadmin2
                    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                    by SEQadmin2



                    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                    07-08-2026, 05:17 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 07-24-2026, 12:17 PM
                  0 responses
                  31 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-23-2026, 11:41 AM
                  0 responses
                  23 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-20-2026, 11:10 AM
                  0 responses
                  214 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-13-2026, 10:26 AM
                  0 responses
                  79 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...