Tweet
nothing aligned using bwa mem
Hi there.
I am using bwa to align human RNA-seq reads to rRNA database to exclude rRNA pollution. I tried both bwa backtrack and mem, and very strangely only backtrack could map some of my reads to rRNA reference, while mem mapped NONE. I think there must be something wrong but I just cannot figure out what. My command is listed below:
backtrack:
bwa aln -l 20 -f se-reads.sai rRNA.fa se-reads.gz && bwa samse -f se-read-backtrack.sam rRNA.fa se-reads.sai se-reads.gz
mem:
bwa mem -k 17 rRNA.fa se-reads.gz > se-read-mem.sam
My reads were single-ended and the length was 28 bp. The input reads were fastq gzip files.
And I'd like to post a same read for example that was mapped to rRNA reference using backtrack but was not mapped using mem.
backtrack:
GS85516-FS3:L02C002R005.7860.0 0 hsa_rRNA_EU597543_650:1603:+ 519 0 28M * 0 0 AAAGGACCTGGCGGTGCTTCATATCCCG ,,+/#*$#+$##$%,#)')0..1..)#) XT:A:R NM:i:1 X0:i:5519 XM:i:1 XO:i:0 XG:i:0 MD:Z:27T0
mem:
GS85516-FS3:L02C002R005.7860.0 4 * 0 0 * * 0 0 AAAGGACCTGGCGGTGCTTCATATCCCG ,,+/#*$#+$##$%,#)')0..1..)#)AS:i:0 XS:i:0
I am very confused. Can anyone help me with this?
I am using bwa to align human RNA-seq reads to rRNA database to exclude rRNA pollution. I tried both bwa backtrack and mem, and very strangely only backtrack could map some of my reads to rRNA reference, while mem mapped NONE. I think there must be something wrong but I just cannot figure out what. My command is listed below:
backtrack:
bwa aln -l 20 -f se-reads.sai rRNA.fa se-reads.gz && bwa samse -f se-read-backtrack.sam rRNA.fa se-reads.sai se-reads.gz
mem:
bwa mem -k 17 rRNA.fa se-reads.gz > se-read-mem.sam
My reads were single-ended and the length was 28 bp. The input reads were fastq gzip files.
And I'd like to post a same read for example that was mapped to rRNA reference using backtrack but was not mapped using mem.
backtrack:
GS85516-FS3:L02C002R005.7860.0 0 hsa_rRNA_EU597543_650:1603:+ 519 0 28M * 0 0 AAAGGACCTGGCGGTGCTTCATATCCCG ,,+/#*$#+$##$%,#)')0..1..)#) XT:A:R NM:i:1 X0:i:5519 XM:i:1 XO:i:0 XG:i:0 MD:Z:27T0
mem:
GS85516-FS3:L02C002R005.7860.0 4 * 0 0 * * 0 0 AAAGGACCTGGCGGTGCTTCATATCCCG ,,+/#*$#+$##$%,#)')0..1..)#)AS:i:0 XS:i:0
I am very confused. Can anyone help me with this?
Comment