Trimmomatic and Multiplexed Samples

[cbaudo]

Hello and thanks for reading,

I'm performing adapter trimming for the first time using Trimmomatic on paired-end reads. We solicited a third party to generate our RNA-seq libraries and they used the TruSeq® v1/v2/LT Sample Prep Kits. The TruSeq Universal Adapter is
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
which corresponds to the TruSeq2-PE.fa fasta file in the adapter folder. Should I select this fasta file or should I use the adapter sequence for each indexed sample? For example, they have returned my fastq files with my samples and the index used.

Sample1_CCGTCC_L002_R1_001.fastq.gz
Sample2_CCGTCC_L002_R2_001.fastq.gz

Should I use the TruSeq Adapter for the corresponding index to trim?
TruSeq Adapter, Index 16
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTG

I have 21 samples that were multiplexed on a single lane.

Additionally, is trimming prior to alignment necessary? Apologies if this is confusing and thank you for your time.

[GenoMax]

Scanning your sequence files with a trimming program is always a good idea. If you do not have adapter contamination then all reads should pass through intact. You want to remove any extraneous sequence from your reads since this could cause problems downstream.

You can use the file provided with trimmomatic TruSeq2-PE.fa [EDIT: See post #3]. That covers the common part of the TruSeq adapters.

[kmcarr]

You can use the file provided with trimmomatic TruSeq2-PE.fa. That covers the common part of the TruSeq adapters.

Use the TruSeq3-PE.fa file, not the TruSeq2-PE.fa file. The file names in Trimmomatic do not correspond to Illumina kit numbers.

The TruSeq2 file corresponds to very early kits and does not account for indexed adapters. TruSeq3-PE.fa (or TruSeq3-PE-2.fa in the very latest releases of Trimmomatic) is the file you want for any libraries constructed with TruSeq v2 and later.

[cbaudo]

GenoMax and kmcarr,

Thank you both for your responses. They have been extremely helpful.

[cbaudo]

kmcarr,

What are the differences between TruSeq3-PE.fa and TruSeq3-PE-2.fa? I've downloaded the latest release of Trimmomatic and have access to the PE-2 fasta file.

Thanks.

[kmcarr]

kmcarr,

What are the differences between TruSeq3-PE.fa and TruSeq3-PE-2.fa? I've downloaded the latest release of Trimmomatic and have access to the PE-2 fasta file.

Thanks.

Near as I can tell in the '-2' file they have added the same sequences (plus their reverse complements) but using names other than the "PrefixPE/[12]" format. Naming the adapters with the PrefixPE/1 and PrefixPE/2 format is required for Trimmomatic's palindrome trimming mode. My guess (and it's just a guess) is that they added the additional representations of the same adapters so you can use one file for both palindrome trimming mode and more conventional trimming.