Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • seq_GA
    Senior Member
    • Feb 2009
    • 124

    #1

    BWA output interepretation

    Hi,
    I am finding bit difficulties in understading BWA output format (with indels) and following are my queries.

    Code:
    GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
    GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
    :i:3  XO:i:1  XG:i:1  MD:Z:71C0C1
    1. XT:A:U means unique hits and XT:A:R means repeat..
    2. The above query has the desciptor as 70Match, 1 insertion and 4 matches (75 bp query). If I go to UCSC blat to check this part, first 70 bases matches with the ref (hg18) sequnces and the last GATC is not in that position followed by an insertion in 71st position. Its bit confusing at this stage.
    3. How to intrepret
    Code:
    XO:i:1  XG:i:1
    Number of gaps and gap extentions. If my understanding is correct, it opens 1 gap and extended to 1 base. I am trying to understnad the above read results.
    3. Sometimes BWA gives XA: (alternate hits) for XT:A:R (multiple hits). Is tehre any threshold for BWA to report these alternate hits. Sometimes I see X0:i:10 ( number of best hits as 10) but alternate hits reports only 3 or 4. Is there any threshold to report alternate hits as I believe BWA doesnot report all alternate hits for every multiple hits.
    4. I also want to know about the mismatch tag
    Code:
    MD:Z:71C0C1
    explanation.

    I would appreciate very much if someone could explain my above queries. Thanks.
  • seq_GA
    Senior Member
    • Feb 2009
    • 124

    #2
    Another example which has both deletions as well as insertion as below:

    Code:
    GA1_0001:5:1:2203:13069#0   0       chr7    143975167       37      68M1D4M2I1M     *       0       0       TCCATCACTGATCAAGAGTGGGGTGGCAGGTATTAGG
    GATAATATTCATTTAGCTTTCTGAGCTTTCTGAGATCG     CCCCCCCCCCCCCCCCCCCDCCCCCBBCCCACCCCCCCCCCCCCCCCCCCCCCCCC@CCCCCCCCCCBCACCCCC     XT:A:U  NM:i:4  X0:i:1  X1
    :i:0  XM:i:3  XO:i:1  XG:i:1  MD:Z:68^G1G3
    How do I intrepret the above result. Thanks.

    Comment

    • seq_GA
      Senior Member
      • Feb 2009
      • 124

      #3
      Can anyone comment on my queries above? Thx.

      Comment

      • nilshomer
        Nils Homer
        • Nov 2008
        • 1283

        #4
        Originally posted by seq_GA View Post
        Can anyone comment on my queries above? Thx.
        Sorry for my own impatience, but the answers can be found in the SAM spec and BWA manual.

        Comment

        • seq_GA
          Senior Member
          • Feb 2009
          • 124

          #5
          I did go through the manual and still couldn't figure out whether gap opened and extended are real one of any artifact as I am trying to validate the results.

          As I mentioned below

          Code:
          GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
          GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
          :i:3  XO:i:1  XG:i:1  MD:Z:71C0C1
          I can't figure out MD:Z:71C0C1 and also, 1 gap is opened and extended one bp. But when I blat the same sequence in UCSC blat, its a perfect match.

          And tehre are some example as below whether both insertions and deletion occur in the same read. Is it possible? Thanks.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 07:41 AM
          0 responses
          11 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-03-2026, 10:13 AM
          0 responses
          25 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          38 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          25 views
          0 reactions
          Last Post SEQadmin2  
          Working...