mirdeep2

[menglin]

Dear all,

I am new for miRDeep2. Now I am trying to use the datasets from GEO. But how could I convert the geo txt file to fasta file. I tried to use the command as: geo2fasta.pl ./datas/GSE21279/GSM274171-9598.txt >read.fasta

but the read.fasta file is empty.
This is the geo txt file:

#ID_REF =
#VALUE = number of times small RNA was sequenced
ID_REF VALUE
TCGTATGCCGTCTTCTGCTTGAAAAAA 24660
TCCCTGGTGGTCTAGTGGTTAGGATTC 19051
GGTAAAATGGCTGAGTAAGCATTAGAC 15277
GGCTGGTCCGAAGGTAGTGAGTTATCT 14623
TCCCTGTGGTCTAGTGGTTAGGATTCG 12526
TGAGGTAGTAGGTTGTATGGTTTCGTA 10438
TGAGGTAGTAGATTGTATAGTTTCGTA 9830

[wisense]

Hi, menglin
I think you can use one line awk command to do this kind of job. Something like this:

awk '(NR>3){count+=1; print ">seq_"count"_x"$2"\n"$1}' GSM2741719598.txt > read.fasta

The output read.fasta file may like this:

>seq_1_x24660
TCGTATGCCGTCTTCTGCTTGAAAAAA
>seq_2_x19051
TCCCTGGTGGTCTAGTGGTTAGGATTC

Hope this help you.

wisense

[menglin]

Hi, menglin
I think you can use one line awk command to do this kind of job. Something like this:


The output read.fasta file may like this:


Hope this help you.

wisense

Hi Wisense,

thank you very much for your reply. I have tried to use the awk command. But I want to know the reason why I can not use the script geo2fasta.pl directly. Have you ever used mirDeep2? Maybe I need mire help. Thanks one more time.

[wisense]

Hi Wisense,

thank you very much for your reply. I have tried to use the awk command. But I want to know the reason why I can not use the script geo2fasta.pl directly. Have you ever used mirDeep2? Maybe I need mire help. Thanks one more time.

Yes, I have used mirDeep2 to analize my microRNA-seq data. Because my input was fastq format, I didn't use the geo2fasta.pl script directly. So I can't tell why you can not use the script.

[menglin]

Yes, I have used mirDeep2 to analize my microRNA-seq data. Because my input was fastq format, I didn't use the geo2fasta.pl script directly. So I can't tell why you can not use the script.

Hi Wisense,

thank you all the same. Is it possible to give me your email or fb so that contact with you directly per email if I have further questions? My email is [email protected]

[wisense]

Hi Wisense,

thank you all the same. Is it possible to give me your email or fb so that contact with you directly per email if I have further questions? My email is [email protected]

You are welcome. Here is my e-mail address: [email protected]. I don't use fb, because it's been blocked by the Chinese government

[menglin]

You are welcome. Here is my e-mail address: [email protected]. I don't use fb, because it's been blocked by the Chinese government

yes yes. I forgot that. Google was also blocked. Thank you very much!

[menglin]

You are welcome. Here is my e-mail address: [email protected]. I don't use fb, because it's been blocked by the Chinese government

Hi wisense,

I have a question about mirDeep2. For quantifier and mirdeep2 scripts, we
need to use the known miRNA precursor and mature miRNA. But if we download
the datasets from mirBase. What we get is the entire known miRNA. So
should we extract the miRNA we need using python/perl script or linux
command? Thank you very much for your help.