Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • CIGAR inconsist with read length. Does Bowtie2 reedit read sequence?

    Hi, guys

    I used bowtie2 to align paired-end reads to hg19 genome, and got the sam format output. Then when I tried to convert the sam into bam, I found some error information:
    Code:
    [samopen] SAM header is present: 25 sequences.
    Line 817574, sequence length 124 vs 125 from CIGAR
    Parse error at line 817574: CIGAR and sequence length are inconsistent
    So, I looked into the sam file, and found the line 817574 is like:
    Code:
    HISEQ04:185:C62CTANXX:3:1101:8017:19749	99	chr2	184686606	42	125M	=	184686727	246	TAGAAAAACTAAACAATGAACCGATAAAAAAACTACAACAACTTTTTAAGACGTAGATAATATAATACAATGTAAATAGAATCAACAAAAATTTTTTAAAATGAATGGTAAGAAAGGATTATTA	BBBBBFFFFFFFFFFFFFFFFFFFFFFFF<FFFFFFFFBFBFFFFFFFFFFBFFFFFFFFFFFFBFFFFFFFFBFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFBFFFF<F7F<FFFF<BF<F	AS:i:0	XN:i:0	XM:i:0	XO:i:0	XG:i:NM:i:0	MD:Z:125	YS:i:0	YT:Z:CP
    The CIGAR is 125M, which means the read is 125bp and each base is match/mismatch, while the read sequence is only 124bp. As I know, my paired-end reads are 125bp in sequencing. I think bowtie2 has reedited the sequence of the read, so I compared the sequence in the original fastq file and the bowtie2 alignment:
    Code:
    Seq in Fastq:
    TAGAAAAACTAAACAATGAACCGATAAAAAAACTACAACAACTTTTTAAGACGTAGATAATATAATACAATGTAAATAGAATCAACAAAAATTTTTTAAAATGGCACGATGAAGTTAAGGCATAG
    Seq in Bowtie2 alignment:
    TAGAAAAACTAAACAATGAACCGATAAAAAAACTACAACAACTTTTTAAGACGTAGATAATATAATACAATGTAAATAGAATCAACAAAAATTTTTTAAAATG[COLOR="Red"]AATGGTAAGAAAGGATTATTA[/COLOR]
    It's quite strange the tail bases of the sequence in the alignment are quite different from the fastq file. Somebody know how do this happen? Does Bowtie2 reedit the sequence when it align the read to the reference?

    If you have any idea, please reply me, thanks~
    wisense
    Last edited by wisense; 05-24-2015, 11:03 PM.

  • #2
    It sounds like the sam file got corrupted somehow; I'd suggest re-mappping. And, perhaps, upgrading to the latest version first in case that was a version-specific bug.

    Comment


    • #3
      Originally posted by Brian Bushnell View Post
      It sounds like the sam file got corrupted somehow; I'd suggest re-mappping. And, perhaps, upgrading to the latest version first in case that was a version-specific bug.
      Hi, Brian
      Thanks for your reply.
      My Bowtie 2 version is 2.2.4, I will try the latest version 2.2.5 to see if there's any difference. By the way, there're about 33437 alignments in the sam file their sequence lengths are not 125bp, maybe ranging from 80-120 bp. Quite strange to me.

      Comment


      • #4
        It sounds to me like two processes ran at the same time, one with 125bp reads and one with variable-length reads, and were writing to the same file... just a guess. I suggest you confirm the read count and length distribution of what you think was the input fastq - should be the same as the output sam. The BBMap package has a tool called readlength.sh that you can use to do that quickly.
        Last edited by Brian Bushnell; 05-26-2015, 09:48 AM.

        Comment


        • #5
          Originally posted by Brian Bushnell View Post
          It sounds to me like two processes ran at the same time, one with 125bp reads and one with variable-length reads, and were writing to the same file... just a guess. I suggest you confirm the read count and length distribution of what you think was the input fastq - should be the same as the output sam. The BBMap package has a tool called readlength.sh that you can use to do that quickly.
          Before bowtie2 alignment, I used FastQC to analyze the paired-end reads and both read1 and read2 fastq are 125bp, not with variable-length. BTW, I have used the latest version of bowtie2 (v2.2.5) to re-align the reads to the genome, there's no such error in the alignment. Perhaps, this is a version-specific bug of bowtie2. Thanks for your good suggestion.

          Comment


          • #6
            This is either a very very obscure bug or, more likely, Brian guessed correctly that you have two processes overwriting each other's output (or something along those lines). You might just rerun the alignment.

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Exploring the Dynamics of the Tumor Microenvironment
              by seqadmin




              The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
              07-08-2024, 03:19 PM
            • seqadmin
              Exploring Human Diversity Through Large-Scale Omics
              by seqadmin


              In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
              06-25-2024, 06:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, Today, 11:09 AM
            0 responses
            15 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 07-19-2024, 07:20 AM
            0 responses
            147 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 07-16-2024, 05:49 AM
            0 responses
            121 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 07-15-2024, 06:53 AM
            0 responses
            111 views
            0 likes
            Last Post seqadmin  
            Working...
            X