Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Gianza
    Junior Member
    • Jan 2010
    • 7

    #1

    Fastq adaptors removal/stripping/cleaning

    Hi guys,
    I'm facing such a very dumb problem.
    I cannot find a tool which simply strip off adaptors from Fastq Illumina files. I have contamination from library synthesis adaptors (SMART).
    -Seqclean only works with fasta.
    -Lucy2: libgtk1.2 libraries no longer supported in my linux distro (and I don't even know if it handle fastq)
    -fastx_clipper form FastX-toolkit: makes a big mess, cause it doesn't only strip the adaptor but blow away the whole sequence (it's not supposed to behave like this): it results in loss of more than 1/3 of the dataset.

    Other solutions are integrated in assembler or aligner, but I need a crude trimmed fastq as output.

    Does anybody know something which might be helpful to me?

    Thanks in advance!!

    Davide
  • Adrian_H
    Member
    • Feb 2010
    • 10

    #2
    fastx_clipper seemed to work fine for me. Are you sure you're running it with the parameters you want? (I did have some issues with clipping paired-end reads, where fastx_clipper would blow away one of the sequences if it was too short after clipping, leading to unmatched pairs, and had to modify fastx_clipper to leave sequences in even if they were completely clipped)

    Comment

    • maubp
      Peter (Biopython etc)
      • Jul 2009
      • 1544

      #3
      Personally I use Biopython with some simple adaptor matching.

      There ought to be a tool in EMBOSS to do this too...

      Comment

      • raela
        Member
        • Apr 2010
        • 39

        #4
        With some of the tools in fastx_toolkit, I've found redirection and flags act differently. Most give the option of using -i infile -o outfile or `cat inline | tool > outfile` - if you're using -i -o, try cat in | > out and see if that works better. I forget which one usually gives me issues with it.

        Comment

        • bioinfosm
          Senior Member
          • Jan 2008
          • 483

          #5
          did you try novoaligns adapter trimming? That ought to help
          --
          bioinfosm

          Comment

          • Gianza
            Junior Member
            • Jan 2010
            • 7

            #6
            I'm using this command.
            I want to clarify I'm not a bioinformatician.

            fastx_clipper -a AAGCAGTGGTATCAACGCAGAGTACGCGGG -i 1M_1.txt -M 20 -n -o output.txt

            For Adrian_H: could you please give me your modified version. You just make me remeber the aligner I will use (Mosaik) doesn't accept missing paired-end.

            For raela: Sorry I didn't get your point with cat and pipe..could you please write how should I type it? Thanks!

            However; I found that I have more than one trouble: while blowing away tons of reads with no reason (other than a regular adaptor match, I guess), it also leaves tons of other adapters in the output sequences (e.g. sequences heavily trimmed, and the little remaining stretch....is an adaptor!! )

            If anybody can provide me a working utility, will be my idol.
            (I played so well with SeqClean and cln2qual.....why so many format on this world??)

            Comment

            • Gianza
              Junior Member
              • Jan 2010
              • 7

              #7
              Novoalign seems to have an internal-only trimming pipeline.
              Looking at the manual it doesn't seem it will just return a trimmed fastq, but the final alignment....Am I wrong?

              I would like to avoid conversion to fasta+qual, expecially cause I'm dealing with several dataset (need to report clipping to qual).

              Mosaik, only accepts perfect matching paired sequences (only a missing one and it will stop, thus I'm also concerned about this issue). Have anybody evere dealed with this kind of issue: keep zero length sequences?
              Last edited by Gianza; 07-23-2010, 10:21 AM.

              Comment

              • john_mu
                Member
                • May 2010
                • 88

                #8


                There are some perl scripts there, which might help.
                SpliceMap: De novo detection of splice junctions from RNA-seq
                Download SpliceMap Comment here

                Comment

                • Jose Blanca
                  Member
                  • Aug 2009
                  • 70

                  #9
                  We have build a pipeline, and the first step (the read cleaning) takes care of that. You can take a look at:

                  Comment

                  • Zigster
                    Jeremy Leipzig
                    • May 2009
                    • 117

                    #10
                    Originally posted by Adrian_H View Post
                    fastx_clipper seemed to work fine for me. Are you sure you're running it with the parameters you want? (I did have some issues with clipping paired-end reads, where fastx_clipper would blow away one of the sequences if it was too short after clipping, leading to unmatched pairs, and had to modify fastx_clipper to leave sequences in even if they were completely clipped)
                    yes I have written to the fastx guy about orphaned pairs he said the next version might have some solution. At any rate I think the fastx clipping is too aggressive.
                    --
                    Jeremy Leipzig
                    Bioinformatics Programmer
                    --
                    My blog
                    Twitter

                    Comment

                    • robs
                      Senior Member
                      • May 2010
                      • 116

                      #11
                      Did you try a tool called TagCleaner?




                      It's a web-based tool, but I heard you can contact them if your files are large and they will process them offline for you.

                      Comment

                      • raela
                        Member
                        • Apr 2010
                        • 39

                        #12
                        Not sure if it'll work in your case, but try running it as:
                        cat 1M_1.txt | fastx_clipper -a AAGCAGTGGTATCAACGCAGAGTACGCGGG -M 20 -n > output.txt

                        Comment

                        • vgrubor
                          Junior Member
                          • Sep 2009
                          • 6

                          #13
                          You can use Genome Analysis Toolkit (GATK) to do this. http://www.broadinstitute.org/gsa/wi.../Read_Clipping

                          You can configure it to mask your adapters sequences with Ns so you don't end up with an empty sequence which can cause trouble with aligners when aligning in a paired-end mode.

                          Comment

                          • Zigster
                            Jeremy Leipzig
                            • May 2009
                            • 117

                            #14
                            oops nevermind I see it
                            can someone familiar with FASTX explain to me which 14 nt are aligning here? it seems way too aggressive
                            Code:
                            cat myseq.fq 
                            @HWI-EASXXX/1
                            AACGCGATGCCTCCATTGCTGGTGCAACTGAGCCTGGATATCGGCAGTGCGATCCTCATGGACTTGGATCTGGGTT
                            +HWI-EASXXX/1
                            `_bb_b_bbYbb^bbbaaXbbb`b_a[S``[[MWO`\``]b_bbJ\^Z\J`Y^a[`^[b_bF^b_BBBBBBBBBBB
                            
                            >cat myseq.fq | fastx_clipper -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG -M 14
                            @HWI-EASXXX/1
                            AACGCGATGCCTCCATTGCTGGTGCAACTGAGCCTGG
                            +HWI-EASXXX/1
                            `_bb_b_bbYbb^bbbaaXbbb`b_a[S``[[MWO`\
                            Last edited by Zigster; 07-30-2010, 01:36 PM.
                            --
                            Jeremy Leipzig
                            Bioinformatics Programmer
                            --
                            My blog
                            Twitter

                            Comment

                            • Adrian_H
                              Member
                              • Feb 2010
                              • 10

                              #15
                              If you dig into the fastx_clipper source code, you can see what it's doing (I agree with you that I'm not at all sure that it's the right thing to do though!).

                              if ( alignment_size > 5
                              &&
                              alignment_results.target_start == 0
                              &&
                              (alignment_results.matches * 100 / alignment_size ) >= 75 ) {
                              //printf("--2\n");
                              return alignment_results.query_start ;
                              }

                              I think that this is what is aligning:

                              ATATCGGCAGTGCGAT
                              : ::::: :: ::: :
                              AGATCGGAAGAGCGGT


                              and the it is cutting off everything that follows

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                New Genomics Technologies Take Aim at Long-Standing Limits
                                by SEQadmin2


                                Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                                We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                                ...
                                Yesterday, 10:25 AM
                              • SEQadmin2
                                How Immunogenomics Decodes Immunity’s Genetic Blueprint
                                by SEQadmin2




                                The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                                This convergence of genetics, immunology, and computation...
                                09-01-2026, 05:41 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Today, 09:51 AM
                              0 responses
                              9 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 09-25-2026, 09:06 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 09-23-2026, 11:05 AM
                              0 responses
                              27 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 09-18-2026, 11:37 AM
                              1 response
                              47 views
                              0 reactions
                              Last Post pekgio
                              by pekgio
                               
                              Working...