[seq_GA]

Hi Ben,

Thanks for your prompt response.

with -v 3, Bowtie is also reporting one mapping location.

I want to use seedlength as 28(default) with 2 mismatches. hence I used -n 2 since I am comparing eland_28 and Bowtie results.

But still why Bowtie is not reporting?

[plattsa]

>read1 AGTCTGTTTATGTTCAGCACAATTTTTTTTTTTTG U0 1 0 0 chr8.fa 37178235 R DD

I'm not sure, but didn't the earlier eland only report mismatches over the first 32 bases? Hence mismatches in the final base reads would still allow a U0?

[Ben Langmead]

Hi seq_GA,

I am trying to compare the eland and Bowtie results. Many reads are not getting mapped using Bowtie where as eland reports as unique tags without any mismatch. An example would be as follows:

>read1 AGTCTGTTTATGTTCAGCACAATTTTTTTTTTTTG  U0  1   0  0  chr8.fa 37178235  R DD

Where as Bowtie result for the above read is as follows:

./bowtie -a -m 10 -n 2 --strata --best -p 15 ../Genome/hg18/hg18 -c AGTCTGTTTATGTTCAGCACAATTTTTTTTTTTTG
No results

Can you confirm that it ought to align by looking at the reference? I don't have the hg18 index lying around, but in the h_sapiens_asm index, your example aligns uniquely with 3 mismatches:

./bowtie -a -v 3 /fs/szasmg/langmead/ebwts/h_sapiens_asm -c AGTCTGTTTATGTTCAGCACAATTTTTTTTTTTTG
0	-	gi|51511724|ref|NC_000008.9|NC_000008	37178227	CAAAAAAAAAAAATTGTGCTGAACATAAACAGACT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	31:G>A,33:C>A,34:T>C
Reported 1 alignments to 1 output stream(s)

Also, if you want the output to look like Eland, you should use -v 2 instead of -n 2. -n 2 activates a Maq-like alignment policy.

And also my query would be how Bowtie handles if there are "N"s in the query reads?

An N in a read counts always counts as a mismatch in the alignment.

Thanks,
Ben

[seq_GA]

Hi Ben,

Thanks for support.

I am trying to compare the eland and Bowtie results. Many reads are not getting mapped using Bowtie where as eland reports as unique tags without any mismatch. An example would be as follows:

>read1 AGTCTGTTTATGTTCAGCACAATTTTTTTTTTTTG  U0  1   0  0  chr8.fa 37178235  R DD

Where as Bowtie result for the above read is as follows:

./bowtie -a -m 10 -n 2 --strata --best -p 15 ../Genome/hg18/hg18 -c AGTCTGTTTATGTTCAGCACAATTTTTTTTTTTTG
No results

I have build the reference genome with default parameters.

./bowtie-build <reference_in> <index_baename>

Why Bowtie is not reporting the mapping?
Please let me know whether any changes in the parameters needs to be done.

And also my query would be how Bowtie handles if there are "N"s in the query reads?

Thanks.

[apostrophe]

I was hoping to use Bowtie in order to align a large amount of reads against a genome that has SNPs in the stated format above. If not, I suppose I'll have to figure out some other method of alignment.

Thanks for your quick reply!

[Ben Langmead]

...does Bowtie support FASTA nucleic acid codes that code for two bases, such as Y = T or C for the genome? Thanks in advance.

Bowtie will index and align against references containing non-A/C/G/T characters, but alignments overlapping non-A/C/G/T characters in the reference are invalid and won't be reported.

Out of curiosity, what's the behavior you would like? E.g. if a C in a read were to align against a Y in the genome, would you like that to be considered a match, incurring no penalty against the alignment?

Thanks,
Ben

[apostrophe]

Sorry if this has been answered before, but does Bowtie support FASTA nucleic acid codes that code for two bases, such as Y = T or C for the genome? Thanks in advance.

[Ben Langmead]

Hi Ben,
If I mention '-v 2 -m 1', then one alignment with 2 mismatches (condition) will only be reported?

If you supply -m 1, Bowtie will suppress alignments for reads with more than 1 valid alignment.

I want to find only uniquely aligned reads with atmost 2 mismatches in the seed. My read length is 36bps. How do I set the parameters?

You must pick a definition of "unique." If "unique" = there are no other alignments with the same number of mismatches, then use '--best -strata -m 1', (along with your alignment policy, e.g. '-v 2'). If "unique" = there are no other valid alignments period, then use '-m 1'. The former is stratified, the latter is unstratified.

Ben

[seq_GA]

If you supply '-v 2 -m 1', Bowtie will report an alignment only for reads having 1 legal alignment, regardless of stratum. I.e., if a read has a 1-mismatch alignment and a 2-mismatch alignment, no alignments will be reported for that read. And if a read has just a 2-mismatch alignment, then that alignment will be reported. This is in contrast to stratified mode ('--best --strata'), where the best alignment would be reported in both cases.

Ben

Hi Ben,
Thanks for the clarification. It is still bit confusing. If I mention '-v 2 -m 1', then one alignment with 2 mismatches (condition) will only be reported?

I want to find only uniquely aligned reads with atmost 2 mismatches in the seed. My read length is 36bps. How do I set the parameters?

Regards

[Ben Langmead]

But is if enough for me to use only -m 1 just to extract uniquely aligned hits allowing 2 mismatch as -v 2 ?
Thanks

If you supply '-v 2 -m 1', Bowtie will report an alignment only for reads having 1 legal alignment, regardless of stratum. I.e., if a read has a 1-mismatch alignment and a 2-mismatch alignment, no alignments will be reported for that read. And if a read has just a 2-mismatch alignment, then that alignment will be reported. This is in contrast to stratified mode ('--best --strata'), where the best alignment would be reported in both cases.

Ben

[Ben Langmead]

In both the above example, I tried using --concise as well as complete output format. And for the same sequence, even though it reports the same coordinates, ref_idx seems to be different for both the outputs.

Please let me know.

Hi seq_GA,

--concise rerports the reference according to its internal index, not its name. I.e., the '5' you're seeing is because internally, Bowtie identifies that chromosome as '5' (probably because when you built your index, it was the 6th sequence to be indexed; it's 0-based). If you ask for verbose (default) output and supply the --refidx option with your second input, you should also see '5' in the ref_id column.

Hope that makes sense,
Ben

[seq_GA]

Hi,



Shaun also wrote an email at the time, which I responded to. I should have copied it here but didn't. Here are the salient bits, updated to be relevant to the changes made in 0.10.0:



Answer: yes, -k X --best will report the "best" alignments first.

Ben

But is if enough for me to use only -m 1 just to extract uniquely aligned hits allowing 2 mismatch as -v 2 ?
Thanks

[seq_GA]

Hi Ben,

I get to see different output from the following examples. Please let me know whether I am intrepretting correctly.

./bowtie -a --best -v 2 ../Genome/hg18/hg18 --concise -c gtctggcggcggcctggcggagcg
1+:<21,21852845,0>
Reported 1 alignments to 1 output stream(s)
[]$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 -c gtctggcggcggcctggcggagcg -p 5
0  +  chr22 21852845    GTCTGGCGGCGGCCTGGCGGAGCG        IIIIIIIIIIIIIIIIIIIIIIII 0
Reported 1 alignments to 1 output stream(s)


[]$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 --concise -c gaccaacttgttcagcgccttgat -p 5
1+:<5,132749285,0>
Reported 1 alignments to 1 output stream(s)
[]$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 -c gaccaacttgttcagcgccttgat -p 5
0  +  chr9  132749285   GACCAACTTGTTCAGCGCCTTGAT        IIIIIIIIIIIIIIIIIIIIIIII 0
Reported 1 alignments to 1 output stream(s)

In both the above example, I tried using --concise as well as complete output format. And for the same sequence, even though it reports the same coordinates, ref_idx seems to be different for both the outputs.

Please let me know.

[seq_GA]

Thanks Ben.

[bioinfosm]

thanks Ben ..