[Ben Langmead]

Hi,

Shaun or Ben,

Did you guys get around this?

Shaun also wrote an email at the time, which I responded to. I should have copied it here but didn't. Here are the salient bits, updated to be relevant to the changes made in 0.10.0:

What arguments do you recommend if I just want to report the unique alignments? I have been using -m 2.

Why -m 2 instead of -m 1?

I don't know myself why I've been using -m 2 instead of -m 1. I must have
assumed at some stage that -m counted greater than or equal to.

What definition of "unique" are you after? Is it (a) there are no other legal alignments period, or (b) there are no other legal alignments with the same number of mismatches as the best match? If (b), use --strata --best -m 1, rather than just -m 1.

Is -k X guaranteed to report the lowest mismatch alignments first?

Answer: yes, -k X --best will report the "best" alignments first.

Ben

[bioinfosm]

Shaun or Ben,

Did you guys get around this?

Hi Ben,
Here's one, but I can send you a whole file if you like:

>Test:chr5:15656372:15656404
CTGAGCAAGGGGACCCCAATGGAAAAGTTAGG

This is aligned uniquely (and correctly) by most aligners, but is not aligned by Bowtie with the above arguments. I just noticed that when I remove the "-m 2" option, this read is aligned uniquely. This is counter-intuitive.

What arguments do you recommend if I just want to report the unique alignments? I have been using -m 2.

[Ben Langmead]

How to build index for human genome? Do we need to add individual chrmosomes one by one with the same index name. Pretty confused about this step.

You can specify a comma-separated list of FASTA files as the input to bowtie-build. Example scripts that do this automatically (including the download step) are included in the 'scripts' subdirectory of the Bowtie package. E.g. scripts/make_h_sapiens_asm.sh

Alternately, you can download a pre-built index from the Bowtie website.

After building index, I have to start using bowtie aligner like ./bowtie .. with parameter rite?.

Yes, that's right.

Ben

[Ben Langmead]

I tried bowtie remade with extraflags but it just did the same thing. Would there be a log file somewhere or something in the map file? I can't seem to find any additional output.

Chuck - I turned this into a sourceforge issue so that we can keep all relevant info in one place and not clutter the forum too much:

https://sourceforge.net/tracker/?func=detail&aid=2818544&group_id=236897&atid=1101606

I'll keep looking at this. Thanks for the details.

Ben

[seq_GA]

How to build index for human genome? Do we need to add individual chrmosomes one by one with the same index name. Pretty confused about this step.
After building index, I have to start using bowtie aligner like ./bowtie .. with parameter rite?
Please clarify about buinding different chrmosomes of hg18.
Thanks.

[chuck]

Ben,

I tried bowtie remade with extraflags but it just did the same thing. Would there be a log file somewhere or something in the map file? I can't seem to find any additional output.

Chuck

[chuck]

remove the 'bowtie' binary and rebuild it using 'make EXTRA_FLAGS="-O1" bowtie', then re-run the problematic command using the new binary.

Thanks for your patience,
Ben

doing this now.

I wanted to say that you are the patient one. I know how much work this software development is, particularly in the open environment!

All the best,
Chuck

[Ben Langmead]

Hi Chuck,

If you have the time, there's one more thing it would help to try: remove the 'bowtie' binary and rebuild it using 'make EXTRA_FLAGS="-O1" bowtie', then re-run the problematic command using the new binary.

Thanks for your patience,
Ben

[Ben Langmead]

Hi Bogdan,

I would appreciate to have your comments on the following : when aligning the solexa reads with bowtie,
if a read aligns to multiple genomic regions, is the highest-scored location picked up in the final report
(i.e. when using --best option) ? And if a read aligns with the same score to multiple regions, would it
be possible to see the score of the alignment and the differences in the score among multiple regions ?
In this last scenario, a randomly picked location among the equally scored genomic locations is reported ?

I think your questions will be best answered by referring you to the reporting modes section of the manual, which includes some example invocations of Bowtie. Hope that helps,

Ben

[bogdan]

Hi everyone.

I would appreciate to have your comments on the following : when aligning the solexa reads with bowtie,
if a read aligns to multiple genomic regions, is the highest-scored location picked up in the final report
(i.e. when using --best option) ? And if a read aligns with the same score to multiple regions, would it
be possible to see the score of the alignment and the differences in the score among multiple regions ?
In this last scenario, a randomly picked location among the equally scored genomic locations is reported ?

thanks very much,

bogdan

[chuck]

oops, my bad -

okay, it aborts very quickly using 'bowtie-debug'. Using 'bowtie', it almost finishes but seems to stop working as it approaches the end.

--results using 'debug' below

command>>> ./bowtie-debug -f Castmoll_cp -1 /media/upuna/TD0001/TD0001_3108EAAXX_7_1.fa -2 /media/upuna/TD0001/TD0001_3108EAAXX_7_2.fa /media/upuna/TD0001/TD1_all_castmoll_debug.map

RESULT>>>
Warning: Read (SOLEXA5_68_7_1_25_2044_0_1/1) is less than 3 characters long; skipping...
assert_gt: expected (0) > (0)
ebwt_search_backtrack.h:3265
bowtie-debug: ebwt_search_backtrack.h:3265: virtual void EbwtSeededRangeSourceDriver::setQueryImpl(PatternSourcePerThread*, Range*): Assertion `0' failed.
Aborted

[Ben Langmead]

Ben,

I don't seem to have a ./bowtie-debug command - I made this from the source code on a 64-bit machine.

Chuck

Hi Chuck - sorry, just do 'make bowtie-debug' and that should create it.

Ben

[chuck]

Could you try the same command but using 'bowtie-debug' instead of 'bowtie'? If possible, pick a set of parameters where (a) 'bowtie' hangs and (b) the run doesn't take very long.

Ben,

I don't seem to have a ./bowtie-debug command - I made this from the source code on a 64-bit machine.

Chuck

[Ben Langmead]

Hi Chuck,

Ben,

It still seems to be doing this. When I look at the *map file, it obviously ends without properly finishing, as you can see from the last line.

Could you try the same command but using 'bowtie-debug' instead of 'bowtie'? If possible, pick a set of parameters where (a) 'bowtie' hangs and (b) the run doesn't take very long.

Thanks,
Ben

[chuck]

bowtie 'hanging'

Ben,

It still seems to be doing this. When I look at the *map file, it obviously ends without properly finishing, as you can see from the last line.

SOLEXA8_38_8_100_1783_191_0_2/2 - Castanea 105274 GATCCGTATCATCTTGACTTGGTTCTGATTTCTCTATTTTTTTAAGAATAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0
SOLEXA8_38_8_100_1783_586_0_1/1 + Castanea 107330 CGTTACCTTAACCACAAGGAGGGGGATGCCGAAGGCAGGGCTAGTGACTGG IIIIII

Hi Chuck,

Please post the exact Bowtie version and arguments you're using. Also, please let me know if you see this problem when you use the latest version of Bowtie (0.10.0).

Thanks,
Ben

I just downloaded the latest version last night (0.10.0.2).

The job statement is as follows:

./bowtie -f Castmoll_cp -1 /media/upuna/LH0002/LH0002_302MJAAXX_1_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_2_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_1_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_3_1.fa -2 /media/upuna/LH0002/LH0002_302MJAAXX_1_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_2_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_1_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_3_2.fa /media/upuna/LH0002/LH2_all_castmoll.map

Thanks,
Chuck