[malcook]

Warning: Exhausted best-first chunk memory for read

when I get this message I have found that the following option makes it go away (doubling the default value)

--chunkmbs 128

[david2]

Out of memory with me as well

Hi,
I am also getting:
C:\bowtie-0.12.5>bowtie -c hg18 ATTCAGTAGGTACTATAAATGGCCGAT --chunkmbs 512
Out of memory allocating the ebwt[] array for the Bowtie index. Please try
again on a computer with more memory.
Command: bowtie -c --chunkmbs 512 hg18 ATTCAGTAGGTACTATAAATGGCCGAT

I tried the chunkmbs with 32, 128, 256 and 512 on a winXP32bit with 4GB of RAM, the maximum allocated memory is around 1.2 GB. Any other ideas I could try?
Thanks a lot,

David

--edit--:
I rebooted the system, the task manager shows at least 3.6G of total phys. memory, 2.7GB available and 1.6G cache, I am still getting the request to use a 'computer with more memory'. I thought Bowtie was supposed to run on the human genome with ~ 2GB of RAM?
--edit2--:
I got it to work under a VMWare virtual machine running Ubuntu on the above XP system, without any chunkmbs setting, there is definitely something fishy when running under XP

[seqniru]

Hi,
I am just starting to use Linux and Bowtie so this might be something simple.
I downloaded Bowtie and just wanted to run the example suggested in the tutorial.
I am giving the command
chmod ugo+rwx bowtie e_coli reads/e_coli_1000.fq
I get an error that says chmod cannot access e_coli No such file or directory.
Can't figure out what is wrong.
Help appreciated!
Thanks.

[mrawlins]

The command

chmod ugo+rwx bowtie e_coli reads/e_coli_1000.fq

will change permissions (chmod)
for the user, group and others (ugo)
to include reading, writing and executing permissions (+rwx)
for the files bowtie, e_coli and reads/e_coli_1000.fq

The error is that it can't find a file or directory named e_coli. That will be relative to the directory you are running the command from, so you should try
ls
and see if there are any files named e_coli.

If your filename has a space in it (not recommended) you should be able to put a \ before the space, which should keep the command from thinking you're listing a new file. You could also put the filename with a space in single or double quotes, which may help that same problem.

Hope that helps.

[seqniru]

Thank you mrawlins.
That was very helpful. I finally got bowtie up and running.

[seqniru]

Hi All,
Still trying to figure out Bowtie options.
How do I get it to align reads allowing more than 3 mismatches?
Thanks.

[gzentner]

seqniru,

You might try -v <int>. This ignores quality values and allows up to <int> mismatches. I don't think there's a limit on it, like with -n only going up to 3 mismatches

I also have a question of my own. I am trying to align some data using Bowtie and keep getting an error:

Reads file contained a pattern with more than 1024 quality values.
Please truncate reads and quality values and and re-run Bowtie
terminate called after throwing an instance of 'int'
Aborted

I have looked for solutions to this and tried some but nothing seems to work. My reads and quality strings are the same length, -v does not work.

Here is a file head:

@IL2_1423:1:49:708:540
GTCTCTTTCTTTTAGATGAA
+
>>>>>>>>>>>>>>>>>>>>

I am not sure if this has something to do with the quality string being all >? Any help is appreciated! Thanks.

[seqniru]

Thank you gzentner.
I tried -v but it does not work with number greater than 3 either.

[seqniru]

Still looking for answer to this question.
How do I get it to align reads allowing more than 3 mismatches?
Both -n and -v can only be set to a maximum of 3 mismatches.
Thanks.

[Chipper]

-n 3 allows more mismatches if seed length is less than read length. For more mismatches in the seed you need another aligner like Bfast.

[alvin]

Reverse complement matches

I have some questions about mapping Illumina reads to a genome with bowtie and I really appreciate if you could help me.
My reads are single read and strand-specific, so I did the alignment with bowtie and I realised that there were a lot of reads that aligned to the genome but they were transformed into the reverse complement.
eg:
B1:000000010#0x37397/1 16 chr3 281135 255 22M * 0 0 TGCCGACTTCCCTGAGTGTACC
B1:000000010#0x37397/1 0 chr4 375688 255 22M * 0 0 GGTACACTCAGGGAAGTCGGCA

I would like to align the reads to the forward and the reverse complement of the reference genome but I don't want to align the reverse complement of the reads.
I don't know if there is an option for this.
I'm running bowtie with these parameters:
bowtie -v3 -a -m3 --best --strata -p4 -t -S

Thanks in advance
Best regards


alv

[Xi Wang]

Hi alv,

"To align the reverse complement of the reads" is equivalent "to align the reads to the reverse complement of the reference genome", and the alignment results are the same. You can BLAST or BLAT the read to check the given results.

I have some questions about mapping Illumina reads to a genome with bowtie and I really appreciate if you could help me.
My reads are single read and strand-specific, so I did the alignment with bowtie and I realised that there were a lot of reads that aligned to the genome but they were transformed into the reverse complement.
eg:
B1:000000010#0x37397/1 16 chr3 281135 255 22M * 0 0 TGCCGACTTCCCTGAGTGTACC
B1:000000010#0x37397/1 0 chr4 375688 255 22M * 0 0 GGTACACTCAGGGAAGTCGGCA

I would like to align the reads to the forward and the reverse complement of the reference genome but I don't want to align the reverse complement of the reads.
I don't know if there is an option for this.
I'm running bowtie with these parameters:
bowtie -v3 -a -m3 --best --strata -p4 -t -S

Thanks in advance
Best regards


alv

[masylichu]

Hi, all
I am newer for using the bowtie program to map the short reads.
could someone give me what the parameters (--best --strata -m) stand?

Because when map the short reads to reference genome with the default parameter, in my surprise, there is low ratio.

thanks.

[alvin]

@Xi Wang

Thank you for your response. You are absolutely right!
Best Regards

Hi, all
I am newer for using the bowtie program to map the short reads.
could someone give me what the parameters (--best --strata -m) stand?

Have you taken a look at the bowtie's Manual?

http://bowtie-bio.sourceforge.net/manual.shtml

Hi, all
Because when map the short reads to reference genome with the default parameter, in my surprise, there is low ratio.

What are the optimal parameters?

Depends on the objective of your sequencing and technology that you are using, each one has different cons. E.g. Illumina tend to introduce mismatches in general terms. Roche 454 tend to introduce indels, etc.
Try with -y and -a.
Hope this help

[alvin]

M1

I realized that the -m and -M options are not compatible.
I think it would be useful if we could use both parameters at the same time.
E.g.
If we run the program with this parameters
$ ./bowtie -a -m3 --best --strata

Specifying -m 3 instructs bowtie to refrain from reporting any alignments for reads having more than 3 reportable alignments, --best , best-to-worst order and
specifying --strata in addition to -a and --best causes bowtie to report only those alignments having the least number of mismatches...but what if some read maps twice or three times with the same numer of mismatches?
Bowtie will report all the alignments for this read because they pass the -a -m3 --best --strata filters, so, I think it would be useful if we could add the -M1 option. Then only one alignment (random) will be informed when this happens, so in this way leading to the "uniqness".