[jyoshna.jo]

Can you please tell me what is the cost for sequencing human genome by Applied Biosystem SOLiD? Which is the best sequencer for genome analysis?

[Xi Wang]

Hi All,

I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????

with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????

Thanks a lot.
jo

Generally, there is not a tool simply better than the others. It depends on what your scientific questions are, what kind of data you have, what the purpose is to analyze the data. For example, Bowtie is not suitable to deal with RNA-seq data.

[jyoshna.jo]

Hi All,

I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????

with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????

Thanks a lot.
jo

[alvin]

Reverse complement

I am working on RNA-Seq data and I aligned the reads to a reference genome with bowtie.
I got the output files in SAM format and now I wonder how can I know for each read if it aligns directly or whether it is the reverse complement that aligns to the reference genome in the SAM format file.
I would really appreciate any help.
Best Regards



alvin

[nashp]

n's in data

Hi Ben,
I have a couple of questions regarding how bowtie handles the data. I have a reference genome and a set of reads. My ref sequence has n's and a lot of reads also have n's in between.

How does bowtie handle these n's
1) while building ref genome index?
2) for reads?

Elsewhere in the same thread, I found you sayin that "When Bowtie indexes the reference, it elides non-A/C/G/T characters. So if you index a reference with stretches of Ns, Bowtie will never report an alignment spanning any of the stretches."

Does this mean you chuck n's while building the index? if yes, don't these n's have positional information? are these n's of any importance?

Thanks
Nash

[biznatch]

Hi,
I am also getting:
C:\bowtie-0.12.5>bowtie -c hg18 ATTCAGTAGGTACTATAAATGGCCGAT --chunkmbs 512
Out of memory allocating the ebwt[] array for the Bowtie index. Please try
again on a computer with more memory.
Command: bowtie -c --chunkmbs 512 hg18 ATTCAGTAGGTACTATAAATGGCCGAT

I tried the chunkmbs with 32, 128, 256 and 512 on a winXP32bit with 4GB of RAM, the maximum allocated memory is around 1.2 GB. Any other ideas I could try?
Thanks a lot,

David

--edit--:
I rebooted the system, the task manager shows at least 3.6G of total phys. memory, 2.7GB available and 1.6G cache, I am still getting the request to use a 'computer with more memory'. I thought Bowtie was supposed to run on the human genome with ~ 2GB of RAM?
--edit2--:
I got it to work under a VMWare virtual machine running Ubuntu on the above XP system, without any chunkmbs setting, there is definitely something fishy when running under XP

I'm having the exact same problem, trying to align chip-seq data to hg19, under XP, with 3GB RAM.

[alvin]

M1

I realized that the -m and -M options are not compatible.
I think it would be useful if we could use both parameters at the same time.
E.g.
If we run the program with this parameters
$ ./bowtie -a -m3 --best --strata

Specifying -m 3 instructs bowtie to refrain from reporting any alignments for reads having more than 3 reportable alignments, --best , best-to-worst order and
specifying --strata in addition to -a and --best causes bowtie to report only those alignments having the least number of mismatches...but what if some read maps twice or three times with the same numer of mismatches?
Bowtie will report all the alignments for this read because they pass the -a -m3 --best --strata filters, so, I think it would be useful if we could add the -M1 option. Then only one alignment (random) will be informed when this happens, so in this way leading to the "uniqness".

[alvin]

@Xi Wang

Thank you for your response. You are absolutely right!
Best Regards

Hi, all
I am newer for using the bowtie program to map the short reads.
could someone give me what the parameters (--best --strata -m) stand?

Have you taken a look at the bowtie's Manual?

http://bowtie-bio.sourceforge.net/manual.shtml

Hi, all
Because when map the short reads to reference genome with the default parameter, in my surprise, there is low ratio.

What are the optimal parameters?

Depends on the objective of your sequencing and technology that you are using, each one has different cons. E.g. Illumina tend to introduce mismatches in general terms. Roche 454 tend to introduce indels, etc.
Try with -y and -a.
Hope this help

[masylichu]

Hi, all
I am newer for using the bowtie program to map the short reads.
could someone give me what the parameters (--best --strata -m) stand?

Because when map the short reads to reference genome with the default parameter, in my surprise, there is low ratio.

thanks.

[Xi Wang]

Hi alv,

"To align the reverse complement of the reads" is equivalent "to align the reads to the reverse complement of the reference genome", and the alignment results are the same. You can BLAST or BLAT the read to check the given results.

I have some questions about mapping Illumina reads to a genome with bowtie and I really appreciate if you could help me.
My reads are single read and strand-specific, so I did the alignment with bowtie and I realised that there were a lot of reads that aligned to the genome but they were transformed into the reverse complement.
eg:
B1:000000010#0x37397/1 16 chr3 281135 255 22M * 0 0 TGCCGACTTCCCTGAGTGTACC
B1:000000010#0x37397/1 0 chr4 375688 255 22M * 0 0 GGTACACTCAGGGAAGTCGGCA

I would like to align the reads to the forward and the reverse complement of the reference genome but I don't want to align the reverse complement of the reads.
I don't know if there is an option for this.
I'm running bowtie with these parameters:
bowtie -v3 -a -m3 --best --strata -p4 -t -S

Thanks in advance
Best regards


alv

[alvin]

Reverse complement matches

I have some questions about mapping Illumina reads to a genome with bowtie and I really appreciate if you could help me.
My reads are single read and strand-specific, so I did the alignment with bowtie and I realised that there were a lot of reads that aligned to the genome but they were transformed into the reverse complement.
eg:
B1:000000010#0x37397/1 16 chr3 281135 255 22M * 0 0 TGCCGACTTCCCTGAGTGTACC
B1:000000010#0x37397/1 0 chr4 375688 255 22M * 0 0 GGTACACTCAGGGAAGTCGGCA

I would like to align the reads to the forward and the reverse complement of the reference genome but I don't want to align the reverse complement of the reads.
I don't know if there is an option for this.
I'm running bowtie with these parameters:
bowtie -v3 -a -m3 --best --strata -p4 -t -S

Thanks in advance
Best regards


alv

[Chipper]

-n 3 allows more mismatches if seed length is less than read length. For more mismatches in the seed you need another aligner like Bfast.

[seqniru]

Still looking for answer to this question.
How do I get it to align reads allowing more than 3 mismatches?
Both -n and -v can only be set to a maximum of 3 mismatches.
Thanks.

[seqniru]

Thank you gzentner.
I tried -v but it does not work with number greater than 3 either.

[gzentner]

seqniru,

You might try -v <int>. This ignores quality values and allows up to <int> mismatches. I don't think there's a limit on it, like with -n only going up to 3 mismatches

I also have a question of my own. I am trying to align some data using Bowtie and keep getting an error:

Reads file contained a pattern with more than 1024 quality values.
Please truncate reads and quality values and and re-run Bowtie
terminate called after throwing an instance of 'int'
Aborted

I have looked for solutions to this and tried some but nothing seems to work. My reads and quality strings are the same length, -v does not work.

Here is a file head:

@IL2_1423:1:49:708:540
GTCTCTTTCTTTTAGATGAA
+
>>>>>>>>>>>>>>>>>>>>

I am not sure if this has something to do with the quality string being all >? Any help is appreciated! Thanks.