Hi All,
Still trying to figure out Bowtie options.
How do I get it to align reads allowing more than 3 mismatches?
Thanks.
Unconfigured Ad
Collapse
X
-
Thank you mrawlins.
That was very helpful. I finally got bowtie up and running.
Leave a comment:
-
The command
chmod ugo+rwx bowtie e_coli reads/e_coli_1000.fq
will change permissions (chmod)
for the user, group and others (ugo)
to include reading, writing and executing permissions (+rwx)
for the files bowtie, e_coli and reads/e_coli_1000.fq
The error is that it can't find a file or directory named e_coli. That will be relative to the directory you are running the command from, so you should try
ls
and see if there are any files named e_coli.
If your filename has a space in it (not recommended) you should be able to put a \ before the space, which should keep the command from thinking you're listing a new file. You could also put the filename with a space in single or double quotes, which may help that same problem.
Hope that helps.
Leave a comment:
-
Hi,
I am just starting to use Linux and Bowtie so this might be something simple.
I downloaded Bowtie and just wanted to run the example suggested in the tutorial.
I am giving the command
chmod ugo+rwx bowtie e_coli reads/e_coli_1000.fq
I get an error that says chmod cannot access e_coli No such file or directory.
Can't figure out what is wrong.
Help appreciated!
Thanks.
Leave a comment:
-
Out of memory with me as well
Hi,
I am also getting:
C:\bowtie-0.12.5>bowtie -c hg18 ATTCAGTAGGTACTATAAATGGCCGAT --chunkmbs 512
Out of memory allocating the ebwt[] array for the Bowtie index. Please try
again on a computer with more memory.
Command: bowtie -c --chunkmbs 512 hg18 ATTCAGTAGGTACTATAAATGGCCGAT
I tried the chunkmbs with 32, 128, 256 and 512 on a winXP32bit with 4GB of RAM, the maximum allocated memory is around 1.2 GB. Any other ideas I could try?
Thanks a lot,
David
--edit--:
I rebooted the system, the task manager shows at least 3.6G of total phys. memory, 2.7GB available and 1.6G cache, I am still getting the request to use a 'computer with more memory'. I thought Bowtie was supposed to run on the human genome with ~ 2GB of RAM?
--edit2--:
I got it to work under a VMWare virtual machine running Ubuntu on the above XP system, without any chunkmbs setting, there is definitely something fishy when running under XPLast edited by david2; 08-26-2010, 12:06 PM. Reason: Added more info about the system... works under VMWare/Ubuntu
Leave a comment:
-
Warning: Exhausted best-first chunk memory for read
when I get this message I have found that the following option makes it go away (doubling the default value)
--chunkmbs 128
Leave a comment:
-
I'm running Bowtie for the first time and I keep getting:
Out of memory allocating the ebwt[] array for the Bowtie index. Please try
again on a computer with more memory.
I'm using the hg19 index and am running on a 32-bit system with 4 GB of memory. I've tried to reduce the memory usage with offrate, but it doesn't seem to help.
I've even gone so far as to boot into safe mode to use the command prompt with low memory use, and I don't see bowtie allocate anymore than 890 MB of memory.Last edited by edchen; 08-20-2010, 08:14 AM.
Leave a comment:
-
Can anyone tell me what this warning means? I can't find any documentation for it:
"Warning: Exhausted best-first chunk memory for read IPAR1:1:11:15296:1878:1#0/1 (patid 2434682); skipping read"
Thanks for any help!
-Kris
Leave a comment:
-
Please help with genome reseq parameter suggestion for PE 100mer data (D. melanogaster)
What are people going with as the 'default' alignment parameters/workflow?
I'm wondering if people are using -x and if so what value? Is it better to allow for structural variations with a large -x value or to even leave it out?
Is using -m1 and --max part of the workflow?
Also what combination of -l/-n/-e do people find works well with PE 100mers? Obviously it depends on data quality.
Leave a comment:
-
Regarding the disparate -m1 vs -a
Thanks for a reply,
I posted the input reads so that someone could run bowtie using that input against human chromosome #1 and see the results for themselves, as it is so small and easily done.
I HAVE run the same input using two input fasta files and the results are identical. Easier to post the contents of the --12 file.
bowtie output tells you how many reads were "suppressed" due to the -m setting so the fact that pairs 1, 8 show up with -m1 and then show up multiple alignments with -a is not expected behavior as I understand it.
It's a good idea to run each pair by itself. I'll try that and see if it enlightens me further.
Thanks again.
Susan
Leave a comment:
-
Hi Susan,Originally posted by axiom7 View PostHi all,
I thought I asked a reasonable question...
Susan
I am still a beginner in using Bowtie, but here go some suggestions and comments:
1. The x.12.fa is your input file, right? Have you tried to separate the two reads of the pairs into two separate files and then run the mapping? Why are you pasting the input sequences here, I thought you had doubts about the alignment results?
2. Have you tried each of these reads separately, lets say with the -a option?
3. As far as I understand, -m1 only reports reads with exactly one alignment, not at least one alignment.Originally posted by axiom7 View PostWhen I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m.
Leave a comment:
-
More on disparate results between -a vs -m1
Hi all,
I thought I asked a reasonable question...
Susan
Leave a comment:
-
Dummy question
Dear all,
I have tried running bowtie for the first time. I run it with the following parameters: ./bowtie -t -3 5 -p 8 hg19 reads/my_reads_file.txt hg19.map
However after the program has finished calculating, I do not see the output file. A second puzzling thing is that it writes to the screen that only ~1% of my reads mapped to the genome. Do you have any ideas what is wrong?
Thank you!
Leave a comment:
-
More on disparate results between -a vs -m1
Hi again,
Have not gotten any reply to my posting, so I thought I'd make it a little easier for you. I am pasting the --12, 10-line input file and the two commands which quickly and easily reproduce my (perhaps perceived) problem. Again, the reference sequence is human chromosome 1.
Here are the two commands (assuming the --12 file is named x.12.fa and that the reference index is named hschr1):
bowtie -t -f --ff -I700 -X1300 -v0 -y -m1 hschr1 --12 x.12.fa
bowtie -t -f --ff -I700 -X1300 -v0 -y -a hschr1 --12 x.12.fa
And here is x.12.fa:
>0000000000 GAAGCTGAGGTGGGAGGATC IIIIIIIIIIIIIIIIIIII GCTAGGCGTGGTGGCTGGGA IIIIIIIIIIIIIIIIIIII
>0000000001 CCTGGTTCCTGGCACAGAGC IIIIIIIIIIIIIIIIIIII AGGCTGGTCTCAAACTCCTG IIIIIIIIIIIIIIIIIIII
>0000000002 GGAATTTTGTTCTTGCTCAT IIIIIIIIIIIIIIIIIIII GAGCAGTTAAAACAGTTGCT IIIIIIIIIIIIIIIIIIII
>0000000003 CCATAATATCTAGCCTGTAG IIIIIIIIIIIIIIIIIIII AACTACTGAAAAATTTTGAA IIIIIIIIIIIIIIIIIIII
>0000000004 GAACTCATCATTTTTTATGG IIIIIIIIIIIIIIIIIIII CATTGCTTTTGTCCCACCGA IIIIIIIIIIIIIIIIIIII
>0000000005 ATTCATATTGCTACTGAAAT IIIIIIIIIIIIIIIIIIII AGTCCATGAGTGCAGGGAAA IIIIIIIIIIIIIIIIIIII
>0000000006 AGAAAAGGCCAAACTCTGGA IIIIIIIIIIIIIIIIIIII AAAAAAAAGAAGAAGAAGAG IIIIIIIIIIIIIIIIIIII
>0000000007 GATGAAGACCACAGCATCAA IIIIIIIIIIIIIIIIIIII CATGTGTCTGCGCCTGCGCC IIIIIIIIIIIIIIIIIIII
>0000000008 ATGGTTCTTAGCTAGATTCA IIIIIIIIIIIIIIIIIIII GTTGTGTATATTTATCTCTT IIIIIIIIIIIIIIIIIIII
>0000000009 AGCTGAAAAATGGTTGAACC IIIIIIIIIIIIIIIIIIII TGGCTATGTGGGCTCTTTTT IIIIIIIIIIIIIIIIIIII
Thanks.
Susan
Originally posted by axiom7 View PostHi,
I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.
When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.
However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.
Two things don't make sense to me:
1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?
2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?
Of course all runs specify -I700 -X1300.
Thanks.
Susan
Leave a comment:
-
best alignment for paired-end reads
Thanks for the comment. I realized that I actually made a mistake asking my question with the indicated parameters, since '-m 1' automatically reduces the output to reads with "unique" alignments, meaning that there is no sorting necessary.Originally posted by Xi Wang View PostI think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.
The question would rather be if I use the '-a' all alignment output option, whether then there would be a possibility to sort the achieved alignments.
cheers,
Sophia
Leave a comment:
Latest Articles
Collapse
-
by SEQadmin2
The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.
This convergence of genetics, immunology, and computation...-
Channel: Articles
09-01-2026, 05:41 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Today, 10:22 AM
|
0 responses
5 views
0 reactions
|
Last Post
by SEQadmin2
Today, 10:22 AM
|
||
|
Started by SEQadmin2, Yesterday, 12:32 PM
|
0 responses
5 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 12:32 PM
|
||
|
Started by SEQadmin2, 08-24-2026, 10:32 AM
|
0 responses
48 views
0 reactions
|
Last Post
by SEQadmin2
08-24-2026, 10:32 AM
|
||
|
Started by SEQadmin2, 08-20-2026, 11:17 AM
|
0 responses
51 views
0 reactions
|
Last Post
by SEQadmin2
08-20-2026, 11:17 AM
|
Leave a comment: