Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • Xi Wang
    replied
    Originally posted by sdvie View Post
    Dear all,

    I am quite intrigued with Bowtie and the options it offers.
    When trying to figure out the best settings for my application, the following question arose:

    According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

    using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
    alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

    Many thanks for your comments!
    Sophia
    I think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.

    Leave a comment:


  • sdvie
    replied
    best alignment for paired-end reads

    Dear all,

    I am quite intrigued with Bowtie and the options it offers.
    When trying to figure out the best settings for my application, the following question arose:

    According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

    using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
    alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

    Many thanks for your comments!
    Sophia

    Leave a comment:


  • axiom7
    replied
    Disparate results between -m1 and -a

    Hi,

    I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.

    When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.

    However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.

    Two things don't make sense to me:

    1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?

    2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?

    Of course all runs specify -I700 -X1300.

    Thanks.
    Susan
    Last edited by axiom7; 07-15-2010, 12:45 PM.

    Leave a comment:


  • genetic
    replied
    Usual workstation OK?

    Hi all,
    I have tried running Bowtie on a PC with 300 GB disc, 2.66 GHz, 1.98 GB RAM. It says "out of memory allocating [ebwt] array for the Bowtie index".
    I want to map using the human hg18 genome. Are there some hints to run it on such PC or I really need more memory?
    Thanks.
    Last edited by genetic; 07-14-2010, 01:17 AM.

    Leave a comment:


  • James
    replied
    Index problem

    Hi,

    I've been using an index I created for a while now and just realized that the index is only for about half of the fastq file I wanted.

    So I carried out bowtie-inspect and I get this:

    bowtie-inspect -s indexes/cds
    Colorspace 0
    SA-Sample 1 in 32
    FTab-Chars 10
    assert_eq: expected (5320, 0x14c8) got (2526, 0x9de)
    bowtie_inspect.cpp:218
    Assertion failed: (0), function print_index_summary, file bowtie_inspect.cpp, line 218.
    Abort trap


    I have no idea how to go about fixing this. So any help would be much appreciated.

    Thanks, J

    Edit: I Fixed this by splitting up the FASTA file and building multiple indexes.
    Last edited by James; 07-14-2010, 08:33 AM. Reason: Resolution of problem

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by laghs View Post
    I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.
    You may use the option:

    -5/--trim5 <int> trim <int> bases from 5' (left) end of reads

    such as "-5 1"

    Leave a comment:


  • laghs
    replied
    Originally posted by Xi Wang View Post
    I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.
    I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by laghs View Post
    I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

    ../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
    # reads processed: 1
    # reads with at least one reported alignment: 0 (0.00%)
    # reads that failed to align: 1 (100.00%)
    No alignments


    ../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
    0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
    # reads processed: 1
    # reads with at least one reported alignment: 1 (100.00%)
    # reads that failed to align: 0 (0.00%)
    Reported 1 alignments to 1 output stream(s)
    I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.

    Leave a comment:


  • laghs
    replied
    Missed alignment?

    I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

    ../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
    # reads processed: 1
    # reads with at least one reported alignment: 0 (0.00%)
    # reads that failed to align: 1 (100.00%)
    No alignments


    ../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
    0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
    # reads processed: 1
    # reads with at least one reported alignment: 1 (100.00%)
    # reads that failed to align: 0 (0.00%)
    Reported 1 alignments to 1 output stream(s)

    Leave a comment:


  • didymos
    replied
    Originally posted by nilshomer View Post
    For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.
    Thank you!
    very clear presentation. However in my case things are little bit different.
    I am mapping not to the whole genome but only to the miRNA sequences (previously indexed with bowtie-build). If I understand correctly color is identified as color error when after correction sequence can be easily mapped, but in my case this "error" sequence can be just not a miRNA sequence - other RNA type from RNA-seq experiment.
    Question is how many color errors are allowed to be correct in bowtie - how I can set it or how can I switch it off if possible?
    Thanks!

    tomek

    Leave a comment:


  • nilshomer
    replied
    Originally posted by didymos View Post
    Hi,
    I have another question about solid data...:
    I have two different reads:
    T32221113212031121021022123023302010
    and
    T22221113212031121021022123023302010
    In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

    bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
    0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


    bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
    0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

    Why?
    Thanks for any suggestions!
    Best!

    tomek
    For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.
    Attached Files

    Leave a comment:


  • didymos
    replied
    bowtie and solid

    Hi,
    I have another question about solid data...:
    I have two different reads:
    T32221113212031121021022123023302010
    and
    T22221113212031121021022123023302010
    In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

    bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
    0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


    bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
    0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

    Why?
    Thanks for any suggestions!
    Best!

    tomek

    Leave a comment:


  • yeb3czg
    replied
    Xi
    I tried it didn't change anything but I found what was the problem in one of my reads file the format of one lane was not correct
    now it 's working
    thanks

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by yeb3czg View Post
    Hi all

    I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
    >bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

    but I got the message
    "Reads file contained a pattern with more than 1024 sequence characters.
    Please truncate reads and quality values and and re-run Bowtie
    terminate called after throwing an instance of 'int'
    Aborted"

    but if I'm using one file of the paired end reads as single end for alignment it works

    There is no uncalled bases in my reads
    Any idea about this issue ?

    Thank you

    AC
    Have you try to put the option -m ahead, like this?

    Code:
    bowtie  -m 1 -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt > xx.sam

    Leave a comment:


  • yeb3czg
    replied
    Hi all

    I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
    >bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

    but I got the message
    "Reads file contained a pattern with more than 1024 sequence characters.
    Please truncate reads and quality values and and re-run Bowtie
    terminate called after throwing an instance of 'int'
    Aborted"

    but if I'm using one file of the paired end reads as single end for alignment it works

    There is no uncalled bases in my reads
    Any idea about this issue ?

    Thank you

    AC

    Leave a comment:

Latest Articles

Collapse

  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    09-01-2026, 05:41 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 09-18-2026, 11:37 AM
1 response
26 views
0 reactions
Last Post pekgio
by pekgio
 
Started by SEQadmin2, 09-16-2026, 10:23 AM
1 response
36 views
0 reactions
Last Post pekgio
by pekgio
 
Started by SEQadmin2, 09-09-2026, 12:14 PM
0 responses
46 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-09-2026, 11:33 AM
0 responses
33 views
0 reactions
Last Post SEQadmin2  
Working...