Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • mastal
    replied
    Originally posted by kumarS_27 View Post
    yes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.

    I am using a 12GB RAM PC.
    The amount of memory would be plenty if you were mapping short reads to a 3 Mb genome, but with the very long contigs, I don't know.

    Can you monitor how much memory your PC is using before it produces the error?

    I know Bowtie2 is supposed to not have an upper limit for length of reads, but you might be better off using blast to map the contigs back to the reference genome.

    Leave a comment:


  • LizBent
    replied
    Originally posted by M4love View Post
    and I followed these instructions

    http://javastat.stat.wvu.edu/tcltk/Bowtie.html
    If you are unfamiliar with a Linux command line interface, this tutorial may help:



    If you still can't get Bowtie to work, I would find someone local to give you some lessons in how to use Linux and how to install and use Bowtie.

    Good luck!

    Leave a comment:


  • kumarS_27
    replied
    yes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.

    I am using a 12GB RAM PC.

    Leave a comment:


  • mastal
    replied
    Bowtie, an ultrafast, memory-efficient, open source short read aligner

    Have you looked at the 454AllContigs.fna file to check that it is in fasta format?
    If it is, -f should work.

    How much memory does the computer you're using have?

    Leave a comment:


  • kumarS_27
    replied
    error with Bowtie

    [QUOTE=Ben Langmead;2022]Hello all,

    If you work with large genomes and large sets of short reads, please
    take a look at Bowtie (http://bowtie-bio.sf.net), a new open source
    short read aligner written by myself and Cole Trapnell at the
    University of Maryland. Bowtie is an ultrafast, memory-efficient short
    read aligner. It aligns short reads to the human genome at a rate of 25
    million reads per hour on a typical workstation with 2 gigabytes of
    memory. Bowtie indexes the genome with a Burrows-Wheeler index to keep
    its memory footprint small: about 1.3 GB for the human genome. It
    supports alignment policies equivalent to Maq and SOAP, but at much
    greater speeds.

    Hi,

    I have no idea if its a right thread to ask this but any suggestion wrt my issue would be appreciated....

    I have a fasta file with 109 listed contigs. I am trying to align these contigs against a 3 MB reference genome. First I indexed my reference file and then I used the following command:

    ./bowtie2 -f -x proteobacter_SL1 -U 454AllContigs.fna -S halo_output_fasta --ignore-quals

    I got the following error:
    terminate called after throwing an instance of 'std::bad_alloc'
    what(): std::bad_alloc
    bowtie2-align died with signal 6 (ABRT)


    I have obtained my contig file with 109 contig from a 454 fastq file.
    When I tried this fastq against the same indexed reference (offcourse with changed basename), bowtie works perfect but as soon as i changed the tag to -f it throws error.

    Is it a memory problem?? coz the cotigs in the contigs file are quite big, close to 12K or 15K bp.

    any ideas???????

    Leave a comment:


  • dpryan
    replied
    Originally posted by M4love View Post
    Hey where should i type Bowtie
    in the R software or in the terminal?
    In the terminal, bowtie has nothing to do with R.

    Leave a comment:


  • M4love
    replied
    Originally posted by M4love View Post
    Hey where should i type Bowtie
    in the R software or in the terminal?
    and I followed these instructions

    Leave a comment:


  • M4love
    replied
    Thanks a lot though. I really feel stupid

    Leave a comment:


  • M4love
    replied
    Originally posted by LizBent View Post
    Did you follow the installation instructions? If you did, and were successful, you can type

    bowtie

    into the prompt and it will give you the help screen. If you were not, you will get an error. If you need help installing bowtie, find someone locally to help you. There are instructions on the website for how to install bowtie.
    Hey where should i type Bowtie
    in the R software or in the terminal?

    Leave a comment:


  • LizBent
    replied
    Originally posted by M4love View Post
    Hey I had a similar question. I have dowloaded bowtie latest version, but am new to use it. infact i am dumb enough not to know how to open it or use it. I extracted the file and am trying to open it in "terminal" and even R non of it is working.
    Did you follow the installation instructions? If you did, and were successful, you can type

    bowtie

    into the prompt and it will give you the help screen. If you were not, you will get an error. If you need help installing bowtie, find someone locally to help you. There are instructions on the website for how to install bowtie.

    Leave a comment:


  • M4love
    replied
    Hey I had a similar question. I have dowloaded bowtie latest version, but am new to use it. infact i am dumb enough not to know how to open it or use it. I extracted the file and am trying to open it in "terminal" and even R non of it is working.

    Leave a comment:


  • Tobias Kockmann
    replied
    -m parameter in "end-to-end" mode

    Dear Bowtie developers/users,

    I have seen the following line of code in a Nature protocol for aligning 36 bp quality-pre-filtered ChIP-seq reads to the Drosophila genome. I was asking myself, if they are really sensible:

    bowtie -q -m 1 -v 3 --best --strata

    As I under stood from the Bowtie publication, -v mode will create "end-to-end" hits, but totally ignores quality information. The alignment ranking is therefor purely based on the number of mismatches (stratum). Since the max. number of mismatches is set to 3, valid alignments will be allowed to contain up to 3 mismatched position over the complete 36mer. The reporting option -m 1 means that Bowtie will only report an alignment, if the read is unique.

    Lets assumes the following scenarios for a single read:

    a.)
    alignment a, perfect match
    alignment b, 1 mismatched position

    Bowtie will report a, right?

    b.)
    alignment a, perfect match
    alignment b, perfect match

    Bowtie will report no match for the read, since both valid alignments have the same rank.

    But, what do the options --best and --strata trigger in "end-to-end" mode??? Do they do anything?

    Greetings,
    Tobi

    Leave a comment:


  • Dario1984
    replied
    Any plans to implement --best and --strata for paired-end mode ? I get a lot less reads mapping with -v 3 -m 1 because it isn't present.

    Leave a comment:


  • rsinha
    replied
    Bowtie2: How to reproduce example alignment

    I am running Bowtie2 to reproduce the example mentioned in the Manual but all in vain. Here is the example I am trying to reproduce:
    End-to-end alignment example

    Read: GACTGGGCGATCTCGACTTCG
    Reference: GACTGCGATCTCGACATCG

    Alignment:
    Read: GACTGGGCGATCTCGACTTCG
    || || | || || || |||| || ||
    Reference: GACTG--CGATCTCGACATCG

    I will be glad if someone let me know what parameters were used to find above alignment. OR someone who is able to do it
    Last edited by rsinha; 06-01-2012, 05:03 AM.

    Leave a comment:


  • LizBent
    replied
    Hi, Bowtie noob question here. I have some paired read data where there are unpaired reads (that is, these reads were removed in preprocessing because they were too short, so that there are sequences in read1.fastq that are not present in read2.fastq, and vice versa). Can I use this with Bowtie, or should I go back to the raw data and re-process it (to remove primers and adapters) this time without removing any sequences? The data was originally prepared for use with Trinity, which supports unpaired reads in paired end data.

    Leave a comment:

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 11:17 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-18-2026, 10:05 AM
0 responses
18 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-13-2026, 12:22 PM
0 responses
41 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-11-2026, 10:35 AM
0 responses
32 views
0 reactions
Last Post SEQadmin2  
Working...