SAM output from bowtie2

[runnerBio88]

Hi

I have some data from RNAseq which I'm going to map using tophat, but because I don't know the inner mate distance I'm mapping using bowtie2 to get to know this inner distance between reads (I took a subset of 25000 reads from the original data).

The problem I'm having is related to the output, I find it little bit weird and I can't find the column with the inner mate distance (which should be the number 9). And by the way, I'm new into this data.

This is the bowtie2 line:

bowtie2 --sensitive  -x /local/Reference/Homo_sapiens/UCSC/hg19/Sequence/Bowtie2Index/genome -1 Panc042_PDAC_PRITUM_Px00__raw_RNAseq_R1_SUBSET25000.fastq  -2 Panc042_PDAC_PRITUM_Px00__raw_RNAseq_R2_SUBSET25000.fastq -S bowtie2_subset/Pan042_PDCA_PRITUM_Px00_raw_RNAseq_subset.sam &> bowtie2_subset/log_bowtie2.txt

Log

25000 reads; of these:
  25000 (100.00%) were paired; of these:
    7297 (29.19%) aligned concordantly 0 times
    12786 (51.14%) aligned concordantly exactly 1 time
    4917 (19.67%) aligned concordantly >1 times
    ----
    7297 pairs aligned concordantly 0 times; of these:
      2039 (27.94%) aligned discordantly 1 time
    ----
    5258 pairs aligned 0 times concordantly or discordantly; of these:
      10516 mates make up the pairs; of these:
        5801 (55.16%) aligned 0 times
        3773 (35.88%) aligned exactly 1 time
        942 (8.96%) aligned >1 times
88.40% overall alignment rate

First two lanes of sam file

HWI-ST1391:130419:D22RGACXX:4:1101:1389:2058    83      chr7    115578630       42      75M     =       115578540       -165    GATACAAGCTAAGCCTGAGATAATTATTATACAATAAGGATTTACTATTTTTCTCCTTTTATCAGCATTAGGGTC     EFC=F@@8)88(?*BIIIIIGDG@GCFD?:0:***?C??:9??1?>GEEBAA3<+AEEDE<C<$
HWI-ST1391:130419:D22RGACXX:4:1101:1389:2058    163     chr7    115578540       42      75M     =       115578630       165     TCGGGCTTTAATGACTGTACCCAGAAGTTAGTAATTATTTTTCCATGTCAAACAATAAAATTATTTTAATTCTCC     1=:=+=@AFAA4CBE,<+<AEGC88AAFEC41:?C<9:C:DGEII4?*009BG;D/9B>>==B$

Thanks.

[GenoMax]

If you are only running bowtie2 to estimate insert size then you could use BBMerge: http://seqanswers.com/forums/showpos...99&postcount=2

If you end up getting BBMap then using BBMap as a splice aware aligner is also a great option instead of TopHat.

[runnerBio88]

If you are only running bowtie2 to estimate insert size then you could use BBMerge: http://seqanswers.com/forums/showpos...99&postcount=2

If you end up getting BBMap then using BBMap as a splice aware aligner is also a great option instead of TopHat.

Thanks I'll give a try to BBMerge to calculate insert size, as I'm not sure that using Bowtie2 to calculate this is a good option.

Thanks

[dpryan]

SAM files don't report the mate inner distance, they report the (apparent) fragment size, which is 165 rather than 9. The inner mate distance is just that minus the sum of the read lengths.