help with sam files

[frankyue50]

Can someone help me with this rna-seq file:

SOLEXA1_0001:1:90:12539:8935#0 16 chr1 3003182 3 8M1708N28M * 0 0 CCCCCATACCCACCCCCCAATCCCCTACCCACCCAC BCCCCB>6@@@<CCCCCCCB>AAAA=0BCC=CCCBC NM:i:2 XS:A:- NS:i:2

What does NS mean? I couldn't find it in sam document. Thanks.

[mrawlins]

NS is a tag specific to the program you're using to generate your SAM file. I can only guess what it means but it may be in the documentation of the program that generated the file.

NM is a standard tag that's an abbreviation of Number Mismatched(or Nucleotides Mismatched). In a similar vein, NS may be Number Substituted, in which case it differs from NM by insertion/deletion of individual nucleotides.
Because NS is not in the standard, any program that reads this SAM file can interpret it in any way. Most will simply ignore it.

[frankyue50]

Thanks. The rna-seq data was processed by tophat. I think the line in my example is a junction. what do you guys think?

NS is a tag specific to the program you're using to generate your SAM file. I can only guess what it means but it may be in the documentation of the program that generated the file.

NM is a standard tag that's an abbreviation of Number Mismatched(or Nucleotides Mismatched). In a similar vein, NS may be Number Substituted, in which case it differs from NM by insertion/deletion of individual nucleotides.
Because NS is not in the standard, any program that reads this SAM file can interpret it in any way. Most will simply ignore it.

[john_mu]

EDIT: has been answered

[mrawlins]

Ah, well, if it's tophat it's pretty easy to look it up in the code.

Mismatches within min_anchor_len of a splice junction

(from bwt_map.cpp:813 and bwt_map.h:233 in tophat source)

It's mismatches within the anchor of a splice junction. NM covers the entire read, while NS will cover only the anchor.

[frankyue50]

Hi, mrawlins, you are the best! Thanks!

Ah, well, if it's tophat it's pretty easy to look it up in the code.

(from bwt_map.cpp:813 and bwt_map.h:233 in tophat source)

It's mismatches within the anchor of a splice junction. NM covers the entire read, while NS will cover only the anchor.