makeblastdb

[wijerasa]

In blast I used makeblstdb as follows

makeblastdb -in ecoli.ffn -dbtype nucl -out ecolidb.db

Building a new DB, current time: 08/21/2010 11:34:41
New DB name: ecolidb.db
New DB title: ecoli.ffn
Sequence type: Nucleotide
Keep Linkouts: T
Keep MBits: T
Maximum file size: 1073741824B

But I got the following error. I have know idea why.

Error: Unable to open input ecoli.ffn as either FASTA file or BLAST db

Please somebody help me on this
Thank you all!

[robs]

Did you check that the input file is in valid FASTA format and that the path is correct?

If yes, try to post the first lines of the FASTA file here, so people can take a look at it.

[Yushan Hsiao]

makeblastdb

Hi, I have the same problem with building up the database.

My fasta input form is like the following:
>cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop
UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA


And the result of makeblastdb is:

Building a new DB, current time: 11/24/2010 16:17:49
New DB name: mature_database.db
New DB title: Mature miRNA Database
Sequence type: Nucleotide
Keep Linkouts: T
Keep MBits: T
Maximum file size: 1073741824B
Error: Input format not recognized ====> ???????????



Dose anyone know the reason?

[robs]

I would guess that you have to convert your RNA sequences into DNA sequences, as BLAST only works on DNA and protein sequences. You can easily do this using any scripting language. I like perl, so try this one:

perl -p -e 's/\r/\n/g;unless(/^>/){tr/Uu/Tt/}' <rna.fasta >dna.fasta

[Yushan Hsiao]

Thanks!!!! It works!!!

[Wandrille]

I've had a problem with makeblast db too.
Altough it didn't seem like one...at first.

makeblastdb don't make any error message, everything seems just fine but i can't find nor use the db I just made.

Any ideas?

[memeri]

I've had a problem with makeblast db too.
Altough it didn't seem like one...at first.

makeblastdb don't make any error message, everything seems just fine but i can't find nor use the db I just made.

Any ideas?

Make sure you have permission to write in the /db directory.
in linux:
sudo makeblastdb -in ...

[Milimet]

Hi,
I have a naive issue when creating my blast db... no error returned but I can't find the created file in the db dir... Help?

Here is the cmd dialog:

[westerman]

Why don't you also show us the command line where you look for the created file? You say that you can not find it but we have no evidence of that.

[aloliveira]

makeblastdb

Anyone ever notice that the program takes a long time to parse the database (-parse_seqids and -hash_index) in comparsion to old formatdb (-o T) ??


Best wishes,
André