Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • wijerasa
    Junior Member
    • Aug 2010
    • 2

    makeblastdb

    In blast I used makeblstdb as follows

    makeblastdb -in ecoli.ffn -dbtype nucl -out ecolidb.db

    Building a new DB, current time: 08/21/2010 11:34:41
    New DB name: ecolidb.db
    New DB title: ecoli.ffn
    Sequence type: Nucleotide
    Keep Linkouts: T
    Keep MBits: T
    Maximum file size: 1073741824B

    But I got the following error. I have know idea why.

    Error: Unable to open input ecoli.ffn as either FASTA file or BLAST db

    Please somebody help me on this
    Thank you all!
  • robs
    Senior Member
    • May 2010
    • 116

    #2
    Did you check that the input file is in valid FASTA format and that the path is correct?

    If yes, try to post the first lines of the FASTA file here, so people can take a look at it.

    Comment

    • Yushan Hsiao
      Junior Member
      • Aug 2010
      • 6

      #3
      makeblastdb

      Hi, I have the same problem with building up the database.

      My fasta input form is like the following:
      >cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop
      UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
      UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA


      And the result of makeblastdb is:

      Building a new DB, current time: 11/24/2010 16:17:49
      New DB name: mature_database.db
      New DB title: Mature miRNA Database
      Sequence type: Nucleotide
      Keep Linkouts: T
      Keep MBits: T
      Maximum file size: 1073741824B
      Error: Input format not recognized ====> ???????????



      Dose anyone know the reason?

      Comment

      • robs
        Senior Member
        • May 2010
        • 116

        #4
        I would guess that you have to convert your RNA sequences into DNA sequences, as BLAST only works on DNA and protein sequences. You can easily do this using any scripting language. I like perl, so try this one:
        Code:
        perl -p -e 's/\r/\n/g;unless(/^>/){tr/Uu/Tt/}' <rna.fasta >dna.fasta

        Comment

        • Yushan Hsiao
          Junior Member
          • Aug 2010
          • 6

          #5
          Thanks!!!! It works!!!

          Comment

          • Wandrille
            Junior Member
            • Feb 2011
            • 1

            #6
            I've had a problem with makeblast db too.
            Altough it didn't seem like one...at first.

            makeblastdb don't make any error message, everything seems just fine but i can't find nor use the db I just made.

            Any ideas?

            Comment

            • memeri
              Junior Member
              • May 2011
              • 9

              #7
              Originally posted by Wandrille View Post
              I've had a problem with makeblast db too.
              Altough it didn't seem like one...at first.

              makeblastdb don't make any error message, everything seems just fine but i can't find nor use the db I just made.

              Any ideas?
              Make sure you have permission to write in the /db directory.
              in linux:
              sudo makeblastdb -in ...

              Comment

              • Milimet
                Junior Member
                • Sep 2011
                • 1

                #8
                Hi,
                I have a naive issue when creating my blast db... no error returned but I can't find the created file in the db dir... Help?

                Here is the cmd dialog:

                Attached Files

                Comment

                • westerman
                  Rick Westerman
                  • Jun 2008
                  • 1104

                  #9
                  Why don't you also show us the command line where you look for the created file? You say that you can not find it but we have no evidence of that.

                  Comment

                  • aloliveira
                    Member
                    • Aug 2010
                    • 47

                    #10
                    makeblastdb

                    Anyone ever notice that the program takes a long time to parse the database (-parse_seqids and -hash_index) in comparsion to old formatdb (-o T) ??


                    Best wishes,
                    André

                    Comment

                    Latest Articles

                    Collapse

                    • SEQadmin2
                      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by SEQadmin2



                      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                      ...
                      07-09-2026, 11:10 AM
                    • SEQadmin2
                      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                      by SEQadmin2



                      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                      07-08-2026, 05:17 AM
                    • GATTACAT
                      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                      by GATTACAT
                      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                      07-01-2026, 11:43 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, 07-13-2026, 10:26 AM
                    0 responses
                    24 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-09-2026, 10:04 AM
                    0 responses
                    33 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-08-2026, 10:08 AM
                    0 responses
                    21 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-07-2026, 11:05 AM
                    0 responses
                    34 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...