Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • nirav99
    Member
    • Aug 2010
    • 10

    Error found while mapping Illumina data using BWA

    While mapping Illumina data against BWA, I noticed several errors :

    ERROR: Record 58, Read name HWI-ST142_0217:1:63:8795:27966#0, Mate negative strand flag does not match read negative strand flag of mate

    The corresponding reads are

    HWI-ST142_0217:1:63:8795:27966#0 89 chr1 27 0 52M1D48M = 27 0 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGAACCCAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTA BBBBBBB___T^^ddc^bccddYdaa``]^O_U]\bGbbbZ_PZ\ZPT\Zbdaadeeee`ddddd`caccb\bbbbb\bbdcTdddcadddd`dadcdcdXT:A:R NM:i:3 SM:i:0 AM:i:0 X0:i:3 X1:i:1 XM:i:2 XO:i:1 XG:i:1 MD:Z:46T5^T29A18 XA:Z:chr15,+100338770,17M1D83M,3;chr4,-62,82M1D18M,3;chr1,-21,52M1D48M,4;

    HWI-ST142_0217:1:63:8795:27966#0 181 chr1 27 0 * = 27 0 GGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTGGTTAGGG bT\^`^bddad\bdadbbdd``Yc`b\d`dbdd^d`ccc\`bYb`TUXYPeT\eecfdfdeeccfcefcfe\eeccfefeffeffffffffffcfcfeff

    The flag of these reads show up as

    1 0 1 1 0 0 1 - first read (forward strand of mate, reverse strand of query)
    1 0 1 1 0 1 0 1 - second read (reverse strand of mate, reverse strand of query)

    The sixth bit (from the left) for both these reads (mate strand) conflicts with the fifth bit (strand of the query).

    Is this the reason for the error I am seeing ? Is there a way to prevent such errors from occurring ?
    Last edited by nirav99; 09-02-2010, 01:47 PM. Reason: Adding new line for clarity of reading
  • nirav99
    Member
    • Aug 2010
    • 10

    #2
    Picard's command line utility FixMateInformation fixes this error.

    Comment

    • cliff
      Member
      • Oct 2009
      • 41

      #3
      hi, nirav99

      I got the same error "Mate negative strand flag does not match read negative strand flag of mate" and I tried FixMateInformation as:

      java -Xmx2g -jar FixMateInformation.jar INPUT=test.bam OUTPUT=test_fixed.bam VALIDATION_STRINGENCY=SILENT

      but I didn't get the output file and got this error:
      Exception in thread "main" net.sf.samtools.util.RuntimeIOException: Write error; BinaryCodec in writemode; streamed file (filename not available)
      at net.sf.samtools.util.BinaryCodec.writeBytes(BinaryCodec.java:199)
      at net.sf.samtools.util.BinaryCodec.writeBytes(BinaryCodec.java:189)
      at net.sf.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:120)
      at net.sf.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:37)
      at net.sf.samtools.util.SortingCollection.spillToDisk(SortingCollection.java:185)
      at net.sf.samtools.util.SortingCollection.add(SortingCollection.java:140)
      at net.sf.picard.sam.FixMateInformation.doWork(FixMateInformation.java:145)
      at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:156)
      at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:117)
      at net.sf.picard.sam.FixMateInformation.main(FixMateInformation.java:74)
      Caused by: java.io.IOException: No space left on device
      at java.io.FileOutputStream.writeBytes(Native Method)
      at java.io.FileOutputStream.write(FileOutputStream.java:260)
      at java.io.BufferedOutputStream.flushBuffer(BufferedOutputStream.java:65)
      at java.io.BufferedOutputStream.write(BufferedOutputStream.java:109)
      at net.sf.samtools.util.BinaryCodec.writeBytes(BinaryCodec.java:197)


      ....

      Comment

      • nirav99
        Member
        • Aug 2010
        • 10

        #4
        Hi Cliff,

        Please check the disk space where you are running this. The exception indicates

        "Caused by: java.io.IOException: No space left on device"

        Comment

        • cliff
          Member
          • Oct 2009
          • 41

          #5
          thanks for getting back to me. I actually have 15TB left..

          Comment

          • nilshomer
            Nils Homer
            • Nov 2008
            • 1283

            #6
            Could it be that the temporary path is not pointing towards your 15TB?

            Comment

            • drio
              Senior Member
              • Oct 2008
              • 323

              #7
              The scratching happens in /tmp/<user_name>, so the problem was most likely /tmp. Use TMP_DIR to specify a different temporary dir.
              -drd

              Comment

              • cliff
                Member
                • Oct 2009
                • 41

                #8
                I specified a temporary directory which has enough space by

                java -Xmx4g -Djava.io.tmpdir=/home/temp -jar

                it still failed...

                Comment

                • nirav99
                  Member
                  • Aug 2010
                  • 10

                  #9
                  Hi Cliff,

                  TMP_DIR is a command line parameter for Picard tools.

                  So, the way to do it would be

                  java -Xmx4G -jar FixMateInformation.jar I=input.bam O=output.bam TMP_DIR=/home/temp VALIDATION_STRINGENCY=LENIENT

                  Comment

                  • cliff
                    Member
                    • Oct 2009
                    • 41

                    #10
                    Hi, Nirav99

                    Thanks! I tried your command and still failed..

                    Comment

                    • Jeremy37
                      Member
                      • Feb 2011
                      • 17

                      #11
                      Similar error found when using SortSam

                      Hi Cliff. Did you find a solution to your problem? I'm getting the same error, except for me it occurs when calling SortSam. Similar to your case we have lots of space available (62 TB).

                      java -Xmx20g -Xms8g -jar SortSam.jar MAX_RECORDS_IN_RAM=2000000 VALIDATION_STRINGENCY=LENIENT CREATE_INDEX=true SORT_ORDER=coordinate INPUT=sequence.sam OUTPUT=sequence.sorted.bam


                      Runtime.totalMemory()=17176592384
                      Exception in thread "main" net.sf.samtools.util.RuntimeIOException: Write error; BinaryCodec in writemode; streamed file (filename not available)
                      at net.sf.samtools.util.BinaryCodec.writeBytes(BinaryCodec.java:199)
                      at net.sf.samtools.util.BinaryCodec.writeBytes(BinaryCodec.java:189)
                      at net.sf.samtools.util.BinaryCodec.writeString(BinaryCodec.java:285)
                      at net.sf.samtools.BinaryTagCodec.writeTag(BinaryTagCodec.java:168)
                      at net.sf.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:144)
                      at net.sf.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:37)
                      at net.sf.samtools.util.SortingCollection.spillToDisk(SortingCollection.java:201)
                      at net.sf.samtools.util.SortingCollection.add(SortingCollection.java:140)
                      at net.sf.samtools.SAMFileWriterImpl.addAlignment(SAMFileWriterImpl.java:157)
                      at net.sf.picard.sam.SortSam.doWork(SortSam.java:67)
                      at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:157)
                      at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:117)
                      at net.sf.picard.sam.SortSam.main(SortSam.java:79)
                      Caused by: java.io.IOException: No space left on device
                      at java.io.FileOutputStream.writeBytes(Native Method)
                      at java.io.FileOutputStream.write(FileOutputStream.java:297)
                      at java.io.BufferedOutputStream.flushBuffer(BufferedOutputStream.java:82)
                      at java.io.BufferedOutputStream.write(BufferedOutputStream.java:126)
                      at net.sf.samtools.util.BinaryCodec.writeBytes(BinaryCodec.java:197)
                      ... 12 more



                      Originally posted by cliff View Post
                      Hi, Nirav99

                      Thanks! I tried your command and still failed..

                      Comment

                      • rahilsethi
                        Member
                        • May 2010
                        • 22

                        #12
                        Picard java exception

                        Hi I got similar error using Picard MergeSamFiles.jar
                        Wondering if anyone found an answer for it

                        Exception in thread "main" net.sf.samtools.util.RuntimeIOException: java.io.FileNotFoundException: /scratch/temp/sortingcollection.4193001834577553277.tmp (Too many open files)
                        at net.sf.samtools.util.SortingCollection$FileRecordIterator.<init>(SortingCollection.java:445)
                        at net.sf.samtools.util.SortingCollection$MergingIterator.<init>(SortingCollection.java:384)
                        at net.sf.samtools.util.SortingCollection.iterator(SortingCollection.java:254)
                        at net.sf.samtools.util.SortingCollection.iterator(SortingCollection.java:43)
                        at net.sf.samtools.SAMFileWriterImpl.close(SAMFileWriterImpl.java:190)
                        at net.sf.samtools.AsyncSAMFileWriter.synchronouslyClose(AsyncSAMFileWriter.java:42)
                        at net.sf.samtools.util.AbstractAsyncWriter.close(AbstractAsyncWriter.java:78)
                        at net.sf.picard.sam.MergeSamFiles.doWork(MergeSamFiles.java:154)
                        at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
                        at net.sf.picard.sam.MergeSamFiles.main(MergeSamFiles.java:79)
                        Caused by: java.io.FileNotFoundException: /scratch/temp/sortingcollection.4193001834577553277.tmp (Too many open files)
                        at java.io.FileInputStream.open(Native Method)
                        at java.io.FileInputStream.<init>(Unknown Source)
                        at net.sf.samtools.util.SortingCollection$FileRecordIterator.<init>(SortingCollection.java:439)
                        ... 9 more
                        Even in my case the space available in /scratch is around 40T

                        Comment

                        • MolecularToast
                          Junior Member
                          • Aug 2010
                          • 9

                          #13
                          If anyone is still listening to this thread - what versions of bwa is everyone using who is getting this error?

                          Comment

                          • rahilsethi
                            Member
                            • May 2010
                            • 22

                            #14
                            I did not use bwa. I used SHRiMP 2.2.2 for mapping. samtools 1.8 for converting sam to bam and Picard version: 1.74 for combining mapped bam files.

                            Comment

                            • jflowers
                              Member
                              • Oct 2011
                              • 42

                              #15
                              Regarding the java.io.FileNotFoundException: (Too many open files), there are a number of things to do. Picard sorting seems to open so many files that it can overload default limits on unix systems. To deal with this, you can either (1) ask you sys admin to increase the allowable number of open files using ulimit -n or (2) for some picard programs you can increase the value of the MAX_RECORDS_IN_RAM command-line parameter which instructs Picard to store more records in fewer files and reduce the number of open files. (watch out for increased memory usage though). If your using markdups and see this error you can 3) use the command-line para
                              meter MAX_FILE_HANDLES_FOR_READ_ENDS_MAP. By reducing this number, you reduce the number of concurrently open files.

                              On our hpc, ulimit -n == 4096, so I use MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=4000

                              Comment

                              Latest Articles

                              Collapse

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 10:09 AM
                              0 responses
                              9 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-04-2026, 08:59 AM
                              0 responses
                              17 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-02-2026, 12:03 PM
                              0 responses
                              26 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-02-2026, 11:40 AM
                              0 responses
                              21 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...