Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • wdecoster
    replied
    What is that function supposed to do?

    Leave a comment:


  • vklearn
    started a topic Computa DNA

    Computa DNA

    Can someone share me How do I Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC)? Thanks

Latest Articles

Collapse

  • seqadmin
    The Impact of AI in Genomic Medicine
    by seqadmin



    Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
    02-26-2024, 02:07 PM
  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-28-2024, 06:12 AM
0 responses
28 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-23-2024, 04:11 PM
0 responses
74 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
85 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
70 views
0 likes
Last Post seqadmin  
Working...
X