Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Computa DNA

    Can someone share me How do I Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC)? Thanks

  • #2
    What is that function supposed to do?


    Latest Articles


    • seqadmin
      The Impact of AI in Genomic Medicine
      by seqadmin

      Article Coming Soon......
      Today, 02:07 PM
    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin

      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      02-08-2024, 06:33 AM





    Topics Statistics Last Post
    Started by seqadmin, 02-23-2024, 04:11 PM
    0 responses
    Last Post seqadmin  
    Started by seqadmin, 02-21-2024, 08:52 AM
    0 responses
    Last Post seqadmin  
    Started by seqadmin, 02-20-2024, 08:57 AM
    0 responses
    Last Post seqadmin  
    Started by seqadmin, 02-14-2024, 09:19 AM
    0 responses
    Last Post seqadmin  