Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Computa DNA

    Can someone share me How do I Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC)? Thanks

  • #2
    What is that function supposed to do?


    Latest Articles


    • seqadmin
      Exploring the Dynamics of the Tumor Microenvironment
      by seqadmin

      The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
      07-08-2024, 03:19 PM
    • seqadmin
      Exploring Human Diversity Through Large-Scale Omics
      by seqadmin

      In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
      06-25-2024, 06:43 AM





    Topics Statistics Last Post
    Started by seqadmin, 07-19-2024, 07:20 AM
    0 responses
    Last Post seqadmin  
    Started by seqadmin, 07-16-2024, 05:49 AM
    0 responses
    Last Post seqadmin  
    Started by seqadmin, 07-15-2024, 06:53 AM
    0 responses
    Last Post seqadmin  
    Started by seqadmin, 07-10-2024, 07:30 AM
    0 responses
    Last Post seqadmin  