Merging fastQ files and trimming advice

[MP_NGS]

Hello everyone,

I am new to using NGS techniques and the bioinformatics tools for analysing the acquired data so I hope I can get some advice from more experienced users.

My objective: Assemble the draft genome of my sequenced individual by de novo assembly.

I carried out a single NextSeq500 run of one individual. It was a paired-end sequencing run (150 bp) and I ended up with 8 fastQ files (2 reads X 4 lanes).

Do I take the right approach if I just merge these fastQ files (using the ''cat'' tool)? Do the paired-reads stay ''intact'' so to say, which can be then used by the assembly tool?
After merging I will do a FastQC analysis on this merged file and will use cutadapt to remove adapter contamination and reads with low quality:

Cutadapt command
cutadapt \
- a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC \
-q 28 \
-m 20 \

Please let me know if you have any tips or advice a different approach.

[Brian Bushnell]

You can't simply merge all of the files; you need to merge all the read1's into one file, and and the read2's into a second file, keeping the orders the same. For example:

cat L1_R1.fastq L2_R1.fastq L3_R1.fastq L4_R1.fastq > L1234_R1.fastq
cat L1_R2.fastq L2_R2.fastq L3_R2.fastq L4_R2.fastq > L1234_R2.fastq

Then you can use Cutadapt, though personally I'd suggest BBDuk.

[MP_NGS]

That makes sense, I overlooked that part. Thanks for the reply!