Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • edge
    Senior Member
    • Sep 2009
    • 199

    Artemis acceptable input file format problem

    Hi,

    I'm the new user of Artemis. I plan to use Artemis to view my gene prediction from GeneMark and Glimmer's result of my fungus genome.
    Unfortunately, I'm facing a problem when I upload to view the gene prediction result of GeneMark and Glimmer at the same time.
    Due to the overlap gene prediction between two different gene prediction program (GeneMark and Glimmer ), I unable to differentiate whether the viewer shown the result of GeneMark or Glimmer.
    I'm plan to add the "Colour" label column in my GeneMark and Glimmer result file.
    Unfortunately, after I added the "Colour" column, Artemis can't view the result properly

    Below is the input file format that I have used to view the result in Artemis:
    Code:
    FT   gene         complement(1687575..1689053)
    FT                   /note="NODE_120.1.len:75266-31, orf00001, 1515..37"
    FT                   /label=orf00001
    FT   gene         complement(1689257..1689964)
    FT                   /note="NODE_120.1.len:75266-31, orf00004, 2426..1719"
    FT                   /label=orf00004
    FT   gene         complement(1689915..1690289)
    FT                   /note="NODE_120.1.len:75266-31, orf00005, 2751..2377"
    FT                   /label=orf00005
    Fail to view the result in Artemis after I added the detaill of "Colour" column

    Code:
    FT   gene         complement(1687575..1689053)
    FT                   /note="NODE_120.1.len:75266-31, orf00001, 1515..37"
    FT                   /label=orf00001
    [COLOR="Red"]FT                   /colour=7
    [/COLOR]FT   gene         complement(1689257..1689964)
    FT                   /note="NODE_120.1.len:75266-31, orf00004, 2426..1719"
    FT                   /label=orf00004
    [COLOR="Red"]FT                   /colour=7
    [/COLOR]FT   gene         complement(1689915..1690289)
    FT                   /note="NODE_120.1.len:75266-31, orf00005, 2751..2377"
    FT                   /label=orf00005
    [COLOR="Red"]FT                   /colour=7
    [/COLOR]
    Thanks for any experience user of Artemis to share your opinion to solve my problem.
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    Have you tried color (although I think Artemis takes both colour and color) and quotes round the number?

    Also you indentation looks funny to me.

    Comment

    • Hobbe
      Member
      • Apr 2010
      • 29

      #3
      Try saving (in Artemis) your gene prediction results in another format such as EMBL or Genbank. I use EMBL. In this format you should be able to add the color information you need.

      Comment

      • hanifk
        Member
        • Oct 2010
        • 18

        #4
        the \colour is ok for me.
        can you tell us what the error artemis reported?

        maybe your problem is about the number of space.
        in my experience, there are 5 spaces before "gene",and 12 spaces between
        "gene"and "complement",the \colour can't be placed before "complement" in the next line.

        good luck.

        Comment

        • edge
          Senior Member
          • Sep 2009
          • 199

          #5
          Hi hanifk,

          Thanks a lot for your reply and advice.
          Can you show me one of the example that you have tried before to show the \colour?
          Based on the example that I shown previously, only some of the data will show "colour" but some will still remain "colourless" when open with Artemis program
          I think might be the format that I shown previously is not accept by Artemis program.

          Originally posted by hanifk View Post
          the \colour is ok for me.
          can you tell us what the error artemis reported?

          maybe your problem is about the number of space.
          in my experience, there are 5 spaces before "gene",and 12 spaces between
          "gene"and "complement",the \colour can't be placed before "complement" in the next line.

          good luck.

          Comment

          • edge
            Senior Member
            • Sep 2009
            • 199

            #6
            Hi Hobbe,

            The gene prediction result from Genemark and Glimmer only allow me to save the output result in gff format.
            After then, I will write a script to convert the gff format into Artemis acceptable input file format. (as I shown in above)
            Do you mind to show your example that how you shown the color effect in Artemis program?
            Thanks first

            Comment

            • hanifk
              Member
              • Oct 2010
              • 18

              #7
              Originally posted by edge View Post
              Hi hanifk,

              Thanks a lot for your reply and advice.
              Can you show me one of the example that you have tried before to show the \colour?
              Based on the example that I shown previously, only some of the data will show "colour" but some will still remain "colourless" when open with Artemis program
              I think might be the format that I shown previously is not accept by Artemis program.
              I think,Artemis will stop to read when counter invalidate items.
              So,It will only display partly if there are invalidate items.

              In my file,
              Code:
                   gene            365..1696
                   gene            1934..3046
                   gene            3060..3266
                   gene            complement(4927..4199)
                   gene            complement(5276..5924)
              ORIGIN
              TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
              GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
              AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
              TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

              Code:
                   gene            365..1696
                                   /colour=5
                   gene            1934..3046
                                   /colour=6
                   gene            3060..3266
                                   /colour=7
                   gene            complement(4927..4199)
                                   /colour=8
                   gene            complement(5276..5924)
                                   /colour=9
              ORIGIN
              TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
              GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
              AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
              TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC
              Attached Files
              Last edited by hanifk; 11-17-2010, 09:28 PM.

              Comment

              • edge
                Senior Member
                • Sep 2009
                • 199

                #8
                Thanks hanifk.
                Do you have add "FT" in all of your first column?

                Originally posted by hanifk View Post
                I think,Artemis will stop to read when counter invalidate items.
                So,It will only display partly if there are invalidate items.

                In my file,
                Code:
                     gene            365..1696
                     gene            1934..3046
                     gene            3060..3266
                     gene            complement(4927..4199)
                     gene            complement(5276..5924)
                ORIGIN
                TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
                GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
                AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
                TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

                Code:
                     gene            365..1696
                                     /colour=5
                     gene            1934..3046
                                     /colour=6
                     gene            3060..3266
                                     /colour=7
                     gene            complement(4927..4199)
                                     /colour=8
                     gene            complement(5276..5924)
                                     /colour=9
                ORIGIN
                TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
                GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
                AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
                TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

                Comment

                • hanifk
                  Member
                  • Oct 2010
                  • 18

                  #9
                  Originally posted by edge View Post
                  Thanks hanifk.
                  Do you have add "FT" in all of your first column?
                  No, I wrote script to generate the .gbk file
                  I didn't know what FT means,so I didn't contain it.

                  Comment

                  • edge
                    Senior Member
                    • Sep 2009
                    • 199

                    #10
                    Hi Hanifk,
                    Thanks a lot for your example.
                    It is working in my place now
                    Besides that, do you have any experience to show the two or more different gene prediction result (eg. genemark, glimmer, augustus, etc) in Artemis at the same times in order to know the difference gene prediction result by different gene prediction program?

                    Comment

                    • maubp
                      Peter (Biopython etc)
                      • Jul 2009
                      • 1544

                      #11
                      Originally posted by hanifk View Post
                      No, I wrote script to generate the .gbk file
                      I didn't know what FT means,so I didn't contain it.
                      In an EMBL feature table, the lines start with FT, but in a GenBank feature table they don't. Artemis can read both EMBL and GenBank files.

                      Comment

                      • edge
                        Senior Member
                        • Sep 2009
                        • 199

                        #12
                        thanks a lot for your sharing, maubp

                        Comment

                        • bspdlp
                          Junior Member
                          • Jul 2012
                          • 1

                          #13
                          Originally posted by hanifk View Post
                          I think,Artemis will stop to read when counter invalidate items.
                          So,It will only display partly if there are invalidate items.
                          Indeed, this is why your EMBL code is rejected. the "location/qualifier" needs to start at character position 22. In your example at the top the FT...\colour line is correct but the other lines for each gene are missing a couple of space characters.
                          In gbk format, you would be missing the first 4 characters starting at the "key" and the qualifier would start at position 18.

                          Hope this helps someone as this is not written enough in the manuals.

                          Comment

                          • Lsterck
                            Junior Member
                            • Feb 2011
                            • 2

                            #14
                            Originally posted by edge View Post
                            Hi Hanifk,
                            Thanks a lot for your example.
                            It is working in my place now
                            Besides that, do you have any experience to show the two or more different gene prediction result (eg. genemark, glimmer, augustus, etc) in Artemis at the same times in order to know the difference gene prediction result by different gene prediction program?
                            On the left side of your artemis window at the top of each pane you should have some small buttons with '>>' or '<<' on it. These are used to show/hide the different panes you have in the artemis window. By default the top pane is hidden, click on the '>>' underneath the 'Entry:' line, to show it. In that pane the annotations tracks are shown one under the other to make it easy to compare them.
                            I hope it's somewhat what you are looking for.
                            Last edited by Lsterck; 07-20-2012, 05:21 AM.

                            Comment

                            Latest Articles

                            Collapse

                            • SEQadmin2
                              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                              by SEQadmin2



                              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                              ...
                              07-09-2026, 11:10 AM
                            • SEQadmin2
                              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                              by SEQadmin2



                              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                              07-08-2026, 05:17 AM
                            • GATTACAT
                              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                              by GATTACAT
                              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                              07-01-2026, 11:43 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, 07-13-2026, 10:26 AM
                            0 responses
                            18 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-09-2026, 10:04 AM
                            0 responses
                            30 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-08-2026, 10:08 AM
                            0 responses
                            16 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-07-2026, 11:05 AM
                            0 responses
                            34 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...