Artemis acceptable input file format problem

[edge]

Hi,

I'm the new user of Artemis. I plan to use Artemis to view my gene prediction from GeneMark and Glimmer's result of my fungus genome.
Unfortunately, I'm facing a problem when I upload to view the gene prediction result of GeneMark and Glimmer at the same time.
Due to the overlap gene prediction between two different gene prediction program (GeneMark and Glimmer ), I unable to differentiate whether the viewer shown the result of GeneMark or Glimmer.
I'm plan to add the "Colour" label column in my GeneMark and Glimmer result file.
Unfortunately, after I added the "Colour" column, Artemis can't view the result properly

Below is the input file format that I have used to view the result in Artemis:

FT   gene         complement(1687575..1689053)
FT                   /note="NODE_120.1.len:75266-31, orf00001, 1515..37"
FT                   /label=orf00001
FT   gene         complement(1689257..1689964)
FT                   /note="NODE_120.1.len:75266-31, orf00004, 2426..1719"
FT                   /label=orf00004
FT   gene         complement(1689915..1690289)
FT                   /note="NODE_120.1.len:75266-31, orf00005, 2751..2377"
FT                   /label=orf00005

Fail to view the result in Artemis after I added the detaill of "Colour" column

FT   gene         complement(1687575..1689053)
FT                   /note="NODE_120.1.len:75266-31, orf00001, 1515..37"
FT                   /label=orf00001
[COLOR="Red"]FT                   /colour=7
[/COLOR]FT   gene         complement(1689257..1689964)
FT                   /note="NODE_120.1.len:75266-31, orf00004, 2426..1719"
FT                   /label=orf00004
[COLOR="Red"]FT                   /colour=7
[/COLOR]FT   gene         complement(1689915..1690289)
FT                   /note="NODE_120.1.len:75266-31, orf00005, 2751..2377"
FT                   /label=orf00005
[COLOR="Red"]FT                   /colour=7
[/COLOR]

Thanks for any experience user of Artemis to share your opinion to solve my problem.

[maubp]

Have you tried color (although I think Artemis takes both colour and color) and quotes round the number?

Also you indentation looks funny to me.

[Hobbe]

Try saving (in Artemis) your gene prediction results in another format such as EMBL or Genbank. I use EMBL. In this format you should be able to add the color information you need.

[hanifk]

the \colour is ok for me.
can you tell us what the error artemis reported?

maybe your problem is about the number of space.
in my experience, there are 5 spaces before "gene",and 12 spaces between
"gene"and "complement",the \colour can't be placed before "complement" in the next line.

good luck.

[edge]

Hi hanifk,

Thanks a lot for your reply and advice.
Can you show me one of the example that you have tried before to show the \colour?
Based on the example that I shown previously, only some of the data will show "colour" but some will still remain "colourless" when open with Artemis program
I think might be the format that I shown previously is not accept by Artemis program.

the \colour is ok for me.
can you tell us what the error artemis reported?

maybe your problem is about the number of space.
in my experience, there are 5 spaces before "gene",and 12 spaces between
"gene"and "complement",the \colour can't be placed before "complement" in the next line.

good luck.

[edge]

Hi Hobbe,

The gene prediction result from Genemark and Glimmer only allow me to save the output result in gff format.
After then, I will write a script to convert the gff format into Artemis acceptable input file format. (as I shown in above)
Do you mind to show your example that how you shown the color effect in Artemis program?
Thanks first

[hanifk]

Hi hanifk,

Thanks a lot for your reply and advice.
Can you show me one of the example that you have tried before to show the \colour?
Based on the example that I shown previously, only some of the data will show "colour" but some will still remain "colourless" when open with Artemis program
I think might be the format that I shown previously is not accept by Artemis program.

I think,Artemis will stop to read when counter invalidate items.
So,It will only display partly if there are invalidate items.

In my file,

     gene            365..1696
     gene            1934..3046
     gene            3060..3266
     gene            complement(4927..4199)
     gene            complement(5276..5924)
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

     gene            365..1696
                     /colour=5
     gene            1934..3046
                     /colour=6
     gene            3060..3266
                     /colour=7
     gene            complement(4927..4199)
                     /colour=8
     gene            complement(5276..5924)
                     /colour=9
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

[edge]

Thanks hanifk.
Do you have add "FT" in all of your first column?

I think,Artemis will stop to read when counter invalidate items.
So,It will only display partly if there are invalidate items.

In my file,

     gene            365..1696
     gene            1934..3046
     gene            3060..3266
     gene            complement(4927..4199)
     gene            complement(5276..5924)
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

     gene            365..1696
                     /colour=5
     gene            1934..3046
                     /colour=6
     gene            3060..3266
                     /colour=7
     gene            complement(4927..4199)
                     /colour=8
     gene            complement(5276..5924)
                     /colour=9
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

[hanifk]

Thanks hanifk.
Do you have add "FT" in all of your first column?

No, I wrote script to generate the .gbk file
I didn't know what FT means,so I didn't contain it.

[edge]

Hi Hanifk,
Thanks a lot for your example.
It is working in my place now
Besides that, do you have any experience to show the two or more different gene prediction result (eg. genemark, glimmer, augustus, etc) in Artemis at the same times in order to know the difference gene prediction result by different gene prediction program?

[maubp]

No, I wrote script to generate the .gbk file
I didn't know what FT means,so I didn't contain it.

In an EMBL feature table, the lines start with FT, but in a GenBank feature table they don't. Artemis can read both EMBL and GenBank files.

[edge]

thanks a lot for your sharing, maubp

[bspdlp]

I think,Artemis will stop to read when counter invalidate items.
So,It will only display partly if there are invalidate items.

Indeed, this is why your EMBL code is rejected. the "location/qualifier" needs to start at character position 22. In your example at the top the FT...\colour line is correct but the other lines for each gene are missing a couple of space characters.
In gbk format, you would be missing the first 4 characters starting at the "key" and the qualifier would start at position 18.

Hope this helps someone as this is not written enough in the manuals.

[Lsterck]

Hi Hanifk,
Thanks a lot for your example.
It is working in my place now
Besides that, do you have any experience to show the two or more different gene prediction result (eg. genemark, glimmer, augustus, etc) in Artemis at the same times in order to know the difference gene prediction result by different gene prediction program?

On the left side of your artemis window at the top of each pane you should have some small buttons with '>>' or '<<' on it. These are used to show/hide the different panes you have in the artemis window. By default the top pane is hidden, click on the '>>' underneath the 'Entry:' line, to show it. In that pane the annotations tracks are shown one under the other to make it easy to compare them.
I hope it's somewhat what you are looking for.