Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • BLAST possibly returning different results

    Hi to everyone,
    this is my very first post and first of all I'd like to thanks Seqanswers for the possibility offered.

    I've submitted the following sequence to BLASTN:
    CTTGACAAGCTAGCTTTAGTTTAAAAACTCCAACTGCCAAAGGAATTAAATTTTTCTTAAAGTAGTATTTCTAAAATACAATTTTTTTGAATTAGTAGTA

    among the results I received also a single match to the following organism:
    Clostridium botulinum Ba4 str. 657 GenBank CP001083.1

    so I tried and run BLASTN again specifying the organism in the Organism field of BLASTN.

    Surprisingly I did obtain 4 matches now (apart from plasmid). They are highlighted in black as poor results but why did BLASTN provide them now only?

    Thanks for any help
    Last edited by Jona; 08-08-2017, 03:04 AM.

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 06:53 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
34 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
204 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 08:54 AM
0 responses
213 views
0 likes
Last Post seqadmin  
Working...
X