BLAST possibly returning different results

Jona

Junior Member

Join Date: Aug 2017

Posts: 1
- Share
- Tweet
#1

BLAST possibly returning different results

08-08-2017, 03:00 AM

Hi to everyone,
this is my very first post and first of all I'd like to thanks Seqanswers for the possibility offered.

I've submitted the following sequence to BLASTN:
CTTGACAAGCTAGCTTTAGTTTAAAAACTCCAACTGCCAAAGGAATTAAATTTTTCTTAAAGTAGTATTTCTAAAATACAATTTTTTTGAATTAGTAGTA

among the results I received also a single match to the following organism:
Clostridium botulinum Ba4 str. 657 GenBank CP001083.1

so I tried and run BLASTN again specifying the organism in the Organism field of BLASTN.

Surprisingly I did obtain 4 matches now (apart from plasmid). They are highlighted in black as poor results but why did BLASTN provide them now only?

Thanks for any help

Last edited by Jona; 08-08-2017, 03:04 AM.
Tags: None

Previous template Next

Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing

by GATTACAT

Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
- Channel: Articles
Today, 11:43 AM
Nine Things a Sample Prep Scientist Thinks About Before Sequencing

by SEQadmin2

I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

Here are nine questions we think about, in roughly the order they matter, before...
- Channel: Articles
06-18-2026, 07:11 AM
From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
06-02-2026, 10:05 AM

Topics	Statistics	Last Post
New AI Model Captures Long-Range Genomic Signals to Improve RNA Splice Site Prediction by SEQadmin2 Started by SEQadmin2, Yesterday, 05:37 AM	0 responses 7 views 0 reactions	Last Post by SEQadmin2 Yesterday, 05:37 AM
Large-Scale Protein Screen Uncovers Hidden Regulators of Alternative Polyadenylation by SEQadmin2 Started by SEQadmin2, 06-26-2026, 11:10 AM	0 responses 17 views 0 reactions	Last Post by SEQadmin2 06-26-2026, 11:10 AM
Whole-Genome Sequencing Traces Faroe Islands Ancestry to a North Atlantic Founder Population by SEQadmin2 Started by SEQadmin2, 06-17-2026, 06:09 AM	0 responses 51 views 0 reactions	Last Post by SEQadmin2 06-17-2026, 06:09 AM
Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2 Started by SEQadmin2, 06-09-2026, 11:58 AM	0 responses 110 views 0 reactions	Last Post by SEQadmin2 06-09-2026, 11:58 AM

Unconfigured Ad

BLAST possibly returning different results

Latest Articles

ad_right_rmr

News