Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • __sequence
    Member
    • Jun 2011
    • 13

    #1

    Bisulfite sequencing question

    Hi all,

    A (may be) stupid question about bisulfite sequencing: Do we in general expect CpGs to be equally methylated on both strands? For example, I am looking at the processed data from this GEO entry: https://www.ncbi.nlm.nih.gov/geo/que...acc=GSM2439648

    It looks like the methylation levels of CpGs belonging to the same pair but at different strands are very different (compare columns 4 and 8 below), while the sequencing coverage looks good. How to interpret this?

    Thanks!
    chr2 3051114 + 35.7143 14 25 12 42.8571 7 45.4545 11 catgaccaatgaaagacgtagaaaacccaacatt
    chr2 3052114 + 100 16 93.3333 15 87.5 8 88.8889 18 agctgagccatctccccggccccGACCTAGAACT
    chr2 3052120 + 76.4706 17 81.25 16 55.5556 9 76.4706 17 gccatctccccggccccGACCTAGAACTCTTTAG
    chr2 3052240 + 30.7692 13 27.7778 18 20 10 22.2222 9 cagttgaaagccaccacgttgatgctgggaattg
    chr2 3052311 + 50 12 46.6667 15 75 12 87.5 8 cacctgagacatctctcGACCCAGGCACTGTGTT
    chr2 3052400 + 90.9091 11 84.6154 13 90 10 62.5 8 ATCACTTGTCCAAACTCGAAACCGGTAATCCAGA
    chr2 3052406 + 75 12 92.8571 14 90 10 100 6 TGTCCAAACTCGAAACCGGTAATCCAGAAAGCCA
    chr2 3052493 + 50 8 50 12 44.4444 9 42.8571 7 TGAATGCTGTGGGCACCGGGAACCCTGCACACCT
    chr2 3052712 + 80 10 85.7143 7 77.7778 9 70 10 AAGTACAGGTTGATGGCGCAGACCAGCGCCATGA
    chr2 3052722 + 44.4444 9 22.2222 9 60 10 36.3636 11 TGATGGCGCAGACCAGCGCCATGATGCAGGAAGT
    chr2 3052756 + 80 10 100 11 100 9 92.8571 14 GATGGCTTTGCTCAACCGGCCGTTGGCAAACTCC
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    Yes, most methylation is symmetric, I haven't a clue why they're always getting such large differences between strands.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 10:13 AM
    0 responses
    14 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    29 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    22 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    21 views
    0 reactions
    Last Post SEQadmin2  
    Working...