Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • shandley
    Member
    • Sep 2010
    • 59

    #1

    Illumina FastQ Question

    Hi,

    New to working with Illumina data. I am running into some inconsistency issues on what programs will recognize my file. For example, bowtie works just fine with the file, however, Galaxy, the FastX Toolkit and Stampy all give me error messages in regards to line 4 containing the quality information. I have read lots of posts about converting to Sanger, the variety of Illumina generated FastQ formats, but have yet to completely identify the issue. Some of the data is below.

    Any thoughts or recommendations?

    @HWUSI-EAS-100R_0003:8:1:1034:19859#NCCCCC/1
    GGTATGTTAACATTCANTGAGCTATACACTTAAGATTTGTGCACTTTATCATAGTAAGTTATTTGTCAGTTTGAA
    +
    ddadcdeeeedddd^bBa]\ZX[^Xdddaddca^a\dddab^J]`[Y^`^^cLa^c`a`YJWOSSRb\_BBBBBBB
    @HWUSI-EAS-100R_0003:8:1:1034:9367#NCCCTC/1
    CACTGAATGACATGGGACTGTTTGGACAAAACGTGCTATACCTCTACCTCGGGAGGGCCGGTTACACCATACATG
    +
    eceeeeedefcdfcfdcc^a`c^_`_Y^^\M^][^baYa\a^K^^T[]Y^BBBBBBBBBBBBBBBBBBBBBBBBBB
    @HWUSI-EAS-100R_0003:8:1:1035:9515#NCTATG/1
    CGCCGTTTCCCAGTAGGTCTCCTAGAACACTATTTCAATGATGAACAAGGCGAGATCGAGCTCATTGAGACCTCG
    +
    feefffffdfffedcdcbe\bdaa^T^^YaT^_\Sa^\^^YY^^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

    EDIT: Just noticed that there are 75 bp and 76 ascii quality scores. Am I missing something here?

    Many thanks,

    Scott
    Last edited by shandley; 11-18-2010, 08:24 AM.
  • fkrueger
    Senior Member
    • Sep 2009
    • 627

    #2
    Hi Scott,

    regarding FastQ files it is normally a good idea to run FastQC on the data, it might tell you a lot about the sequencing data.


    I guess most programs will complain about the space in the sequence line, for which there is a quality value though. If you delete this space then FastQC wouldn't complain anymore.

    Apparently your data is in Illimunia 1.3+ encoding (Phred64 scale), however you need to find out why the sequence line and the quality value lanes are of different lengths, and why there is a space in the sequence in the first place...

    Comment

    • shandley
      Member
      • Sep 2010
      • 59

      #3
      Thanks fkrueger,

      FastQC recognizes and works with the data as Illumina 1.3+ format. When I run bowtie I turn the --phred64-quals option on.

      The Galaxy complaint is specifically that there are 76 quality scores and only 75 nucleotides ... I guess this is where I will direct my attention and try to sort it all out. If anyone has any suggestions or has run into a similar problem please let me know!

      Scott

      Comment

      • maubp
        Peter (Biopython etc)
        • Jul 2009
        • 1544

        #4
        Originally posted by fkrueger View Post
        I guess most programs will complain about the space in the sequence line, ...
        There is no space in the sequence - it is just the forum rendering it badly, trying to help it line wrap. If the OP had used the [ code ] tag I think it would have looked like this:
        Code:
        @HWUSI-EAS-100R_0003:8:1:1034:19859#NCCCCC/1
        GGTATGTTAACATTCANTGAGCTATACACTTAAGATTTGTGCACTTTATCATAGTAAGTTATTTGTCAGTTTGAA
        +
        ddadcdeeeedddd^bBa]\ZX[^Xdddaddca^a\dddab^J]`[Y^`^^cLa^c`a`YJWOSSRb\_BBBBBBB
        @HWUSI-EAS-100R_0003:8:1:1034:9367#NCCCTC/1
        CACTGAATGACATGGGACTGTTTGGACAAAACGTGCTATACCTCTACCTCGGGAGGGCCGGTTACACCATACATG
        +
        eceeeeedefcdfcfdcc^a`c^_`_Y^^\M^][^baYa\a^K^^T[]Y^BBBBBBBBBBBBBBBBBBBBBBBBBB
        @HWUSI-EAS-100R_0003:8:1:1035:9515#NCTATG/1
        CGCCGTTTCCCAGTAGGTCTCCTAGAACACTATTTCAATGATGAACAAGGCGAGATCGAGCTCATTGAGACCTCG
        +
        feefffffdfffedcdcbe\bdaa^T^^YaT^_\Sa^\^^YY^^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
        This is not valid FASTQ since the quality strings are one character longer than the sequences. Tools which ignore the quality strings may accept this as input anyway if they don't check the length.

        Comment

        • shandley
          Member
          • Sep 2010
          • 59

          #5
          Thanks maubp,

          The data was provided by a collaborating lab. I have written them to ask if they have any insight as to why there is an extra character in the quality string. I am tempted to just eliminate the last value. The quality is low here anyways. But this does assume that the extra character was entered at the end of the string instead of the beginning or middle.

          Thanks again

          Comment

          • maubp
            Peter (Biopython etc)
            • Jul 2009
            • 1544

            #6
            Originally posted by shandley View Post
            The data was provided by a collaborating lab. I have written them to ask if they have any insight as to why there is an extra character in the quality string.
            Probably a bug in their filtering script or something
            Originally posted by shandley View Post
            I am tempted to just eliminate the last value. The quality is low here anyways. But this does assume that the extra character was entered at the end of the string instead of the beginning or middle.
            Yeah - hard to say where the error is.

            P.S. If you hadn't seen this before, I think the trailing BBBB... qualities are Illumina's Read Segment Quality Control Indicator, and can be stripped off, see:
            Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc

            Comment

            • shandley
              Member
              • Sep 2010
              • 59

              #7
              Ahhh ... I thought that trailing BBBBB were suspicious. Based on glancing at the overall run data in FastQC the quality drops off dramatically in the last 10 nt's or so. I think I will just eliminate the trailing quality score and run with it.

              Thanks for all of the rapid an insightful responses.

              Comment

              • bioinfosm
                Senior Member
                • Jan 2008
                • 483

                #8
                There is always the trade-off of trimming and losing information, or including and adding noise. Is it really an accepted convention now to trim all trailing B's from Illumina data? Or the aligner and variant caller using Quality values takes care of odd low quality bases..
                --
                bioinfosm

                Comment

                • shandley
                  Member
                  • Sep 2010
                  • 59

                  #9
                  I am only going to trim the final B to alleviate the conflict I am having (at least until the sequencing center gets back with me and explains the extra quality value). I would actually prefer to include as much data as possible and tune out the low quality stuff using assemblers. My thought on this is that 'low-quality' data actually implies there is some accurate data there. I hate to loose any of the precious information, particularly with illumina short-read data.

                  Comment

                  • maubp
                    Peter (Biopython etc)
                    • Jul 2009
                    • 1544

                    #10
                    I think people running out of memory with Illumina assemblies tend to be much more ruthless with their quality trimming. Read errors push up the unique kmer count, and therefore the memory requirements for something like velvet. As a result, I think the optimal trimming strategy will vary according to the amount and nature of your data, and your assembler and computer resources.

                    Or in other words, YMMV (your mileage may vary)

                    Comment

                    • bioinfosm
                      Senior Member
                      • Jan 2008
                      • 483

                      #11
                      Certainly. Depending on application one can get deep coverage and then trim low Q to end up with really good quality data. Though have not seen anything to point how helpful that is in the end
                      --
                      bioinfosm

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, 08-06-2026, 07:41 AM
                      0 responses
                      23 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-03-2026, 10:13 AM
                      0 responses
                      39 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-31-2026, 02:55 AM
                      0 responses
                      43 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      27 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...