SAMMate 2.4.1 (Stable version) release

[xuguorong]

We have released SAMMate 2.4.1!
In this version, we have fixed some bugs including the bug that SAMMate 2.4 can not run on Windows XP.
The latest version can be downloaded from:

http://sammate.sourceforge.net/download.html

==================================================
The key features provided by SAMMate are:

Calculating genomic feature abundance score using RNA-seq data
Generating signal map for peak detection
Generating wiggle files for visualization
Generating alignment report
Customize gene annotation file
Customize chromosome name in output file
SAM/BAM format conversion
SAM/BAM file sorting

[yehudithasin]

Hi
I tried to use it but it seems to have a problem with the format (it says my sam files have invalid format). Is there anything particular within the regular sam fields required? also I noticed that in example sam files there is no quality field, could that be a problem?

[xuguorong]

Hi,
Thank you for using SAMMate!
Quality field is not important for SAMMate.
For pinpoint your sam file problem, could you post some reads for me?
Than I can check what's going on.

Thanks again.
Guorong

Hi
I tried to use it but it seems to have a problem with the format (it says my sam files have invalid format). Is there anything particular within the regular sam fields required? also I noticed that in example sam files there is no quality field, could that be a problem?

[yehudithasin]

Hi Gurong
Here: (If you give me an email - I can send you an example file

HWUSI-EAS1782_U005R_6_43_14419_8471_0 0 chr1 196863794 255 22M * 0 0 TAGCACCATTTGAAATCGGTTA IHIIIIIIIHIIIIIIIIIIIG NM:i:0 MD:Z:22
HWUSI-EAS1782_U005R_6_55_2961_16900_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA HHHHGHHHHHHGGHHHHHHHHF NM:i:0 MD:Z:22
HWUSI-EAS1782_U005R_6_118_8030_15479_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA HHHHHHGHHHHHHHHGGDGGGG NM:i:0 MD:Z:22
HWUSI-EAS1782_U005R_6_83_17566_16442_0 16 chr4 120445223 255 22M * 0 0 GCTGTAAACATCCGACTGAAAG HH@HHHHGDHGGGGGBDDDGHB NM:i:0 MD:Z:22
HWUSI-EAS1782_U005R_6_93_10317_14695_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIHIIIIII NM:i:0 MD:Z:22
HWUSI-EAS1782_U005R_6_49_9696_14067_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA CA?C-C?=?;<2542+???CD7 NM:i:0 MD:Z:22
HWUSI-EAS1782_U005R_6_14_2461_16776_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA IIIIGIHIHIIIIIIGIIIIII NM:i:0 MD:Z:22


Thanks
Yeudit