Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • xuguorong
    Member
    • Feb 2010
    • 27

    SAMMate 2.4.1 (Stable version) release

    We have released SAMMate 2.4.1!
    In this version, we have fixed some bugs including the bug that SAMMate 2.4 can not run on Windows XP.
    The latest version can be downloaded from:


    ==================================================
    The key features provided by SAMMate are:

    Calculating genomic feature abundance score using RNA-seq data
    Generating signal map for peak detection
    Generating wiggle files for visualization
    Generating alignment report
    Customize gene annotation file
    Customize chromosome name in output file
    SAM/BAM format conversion
    SAM/BAM file sorting
  • yehudithasin
    Member
    • Jan 2011
    • 14

    #2
    Hi
    I tried to use it but it seems to have a problem with the format (it says my sam files have invalid format). Is there anything particular within the regular sam fields required? also I noticed that in example sam files there is no quality field, could that be a problem?
    Yu

    Comment

    • xuguorong
      Member
      • Feb 2010
      • 27

      #3
      Hi,
      Thank you for using SAMMate!
      Quality field is not important for SAMMate.
      For pinpoint your sam file problem, could you post some reads for me?
      Than I can check what's going on.

      Thanks again.
      Guorong

      Originally posted by yehudithasin View Post
      Hi
      I tried to use it but it seems to have a problem with the format (it says my sam files have invalid format). Is there anything particular within the regular sam fields required? also I noticed that in example sam files there is no quality field, could that be a problem?

      Comment

      • yehudithasin
        Member
        • Jan 2011
        • 14

        #4
        Hi Gurong
        Here: (If you give me an email - I can send you an example file

        HWUSI-EAS1782_U005R_6_43_14419_8471_0 0 chr1 196863794 255 22M * 0 0 TAGCACCATTTGAAATCGGTTA IHIIIIIIIHIIIIIIIIIIIG NM:i:0 MD:Z:22
        HWUSI-EAS1782_U005R_6_55_2961_16900_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA HHHHGHHHHHHGGHHHHHHHHF NM:i:0 MD:Z:22
        HWUSI-EAS1782_U005R_6_118_8030_15479_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA HHHHHHGHHHHHHHHGGDGGGG NM:i:0 MD:Z:22
        HWUSI-EAS1782_U005R_6_83_17566_16442_0 16 chr4 120445223 255 22M * 0 0 GCTGTAAACATCCGACTGAAAG HH@HHHHGDHGGGGGBDDDGHB NM:i:0 MD:Z:22
        HWUSI-EAS1782_U005R_6_93_10317_14695_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIHIIIIII NM:i:0 MD:Z:22
        HWUSI-EAS1782_U005R_6_49_9696_14067_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA CA?C-C?=?;<2542+???CD7 NM:i:0 MD:Z:22
        HWUSI-EAS1782_U005R_6_14_2461_16776_0 16 chr11 86397622 255 22M * 0 0 TCAACATCAGTCTGATAAGCTA IIIIGIHIHIIIIIIGIIIIII NM:i:0 MD:Z:22


        Thanks
        Yeudit
        Yu

        Comment

        Latest Articles

        Collapse

        • mylaser
          Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
          by mylaser
          Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
          If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
          This guide explains everything you need to know about...
          Today, 01:13 AM
        • SEQadmin2
          Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
          by SEQadmin2



          Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
          ...
          07-09-2026, 11:10 AM
        • SEQadmin2
          Cancer Drug Resistance: The Lingering Barrier to Rising Survival
          by SEQadmin2



          Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

          There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
          07-08-2026, 05:17 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 07-09-2026, 10:04 AM
        0 responses
        16 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-08-2026, 10:08 AM
        0 responses
        10 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-07-2026, 11:05 AM
        0 responses
        22 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-02-2026, 11:08 AM
        0 responses
        31 views
        0 reactions
        Last Post SEQadmin2  
        Working...