Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • lh3
    Senior Member
    • Feb 2008
    • 686

    #196
    export2sam.pl was developed when CASAVA was not formally released (GApipeline<1.0). I do not have access to export files any more and I cannot fix the problem. Is anyone interested in maintaining this script? Thanks in advance.

    In addition, I would also recommend to remap your reads with bwa/novoalign if you have the capacity. I am not familiar with the latest version of eland. But the old version was not as accurate as the best 3rd-party aligners.

    Comment

    • kjngo
      Junior Member
      • Dec 2009
      • 6

      #197
      can someone please help me with this error in BWA/Samtools:

      [samopen] SAM header is present: 89 sequences.
      [sam_read1] reference '29118' is recognized as '*'.
      Parse error at line 3165090: sequence and quality are inconsistent
      /opt/gridengine/default/spool/compute-0-6/job_scripts/204180: line 20: 20739 Aborted (core dumped) /share/apps/samtools/samtools view -bS Tso7_Lib1_CTAG_aln.sam >Tso7_Lib1_CTAG_aln.bam
      [bam_sort_core] truncated file. Continue anyway.

      sorry I am new at this.

      Comment

      • lh3
        Senior Member
        • Feb 2008
        • 686

        #198
        @kjngo

        This is a known bug in bwa (not samtools). Please check out the latest SVN with:

        svn co https://bio-bwa.svn.sourceforge.net/...-bwa/trunk/bwa bwa

        Comment

        • NSTbioinformatics
          Member
          • Apr 2009
          • 24

          #199
          Thank you Li Heng and Kmcarr.
          I did not pay attention to the slight difference of s_N_export.txt and s_N_sorted.txt.

          I will try to modify export2sam to sorted2same, hope i could find time to do so.

          We are happy to the result of eland (illumina pipeline 1.5) that mapped 72.46% of unique mapped reads, while maq mapped 62.71% of unique mapped reads with the same setting of allowing at most 2 mismatches.

          Comment

          • kjngo
            Junior Member
            • Dec 2009
            • 6

            #200
            Thank you lh3

            Comment

            • NSTbioinformatics
              Member
              • Apr 2009
              • 24

              #201
              Just modified a few lines of export2sam.pl to the new script sorted2sam.pl
              sorted2sam.pl works very well to process S_N_sorted.txt (eland alignment) for single reads.
              I did not test to it to parse paired end reads. It may not work well.

              If someone wants to the script, please send email to [email protected]

              Thank everyone for giving me some help.

              By the way, i am going to the Illumina user symposim in April 27-29 in spain. I may meet someone of you there.

              Comment

              • luisczul
                Member
                • May 2009
                • 10

                #202
                Maq2Sam not working propertly?

                Hello,

                I ran the script Maq2Sam on my mapping files and the pileup file coming from the sam file is not even as close (in size and number of bases assembled) as the maq pileup file.

                Does anybody know how to fix this? Or maybe another way to go from Map. files from maq to samtools?

                Thanks,

                Comment

                • wuhoucdc
                  Member
                  • Oct 2009
                  • 14

                  #203
                  Hi lh3,

                  Does SAMtools call SV currently? Thanks

                  Wuhoucdc

                  Comment

                  • lh3
                    Senior Member
                    • Feb 2008
                    • 686

                    #204
                    Try breakdancer.

                    Comment

                    • NSTbioinformatics
                      Member
                      • Apr 2009
                      • 24

                      #205
                      Question about the output of bwa?

                      I got the output, see below:
                      HWI-EAS307:1:54:758:902#0 20 19641_CLSZ1904.b1_P20.ab1_CLSZ_L._sativa_library_forward_335 301 20 36M * 0 0 CAAATCGGTGTGTTTTCACTGGTCGTGCTCGTTCCG aabaaaaaaaaababaa`aaaabaabaabbabaaaa XT:A:U NM:i:1 X0:i:1 X1:i:2 XM:i:1 XO:i:0 XG:i:0 MD:Z:35T0 XA:Z:13134_QGB27J17.yg.ab1_QGB_L._sativa_library_forward_448,-58,36M,2;7061_CLS_S3_Contig6993_CLS_S3_L._sativa_library_forward_968,-404,36M,2;

                      I can not understand the flag value 20. I used "samse" to process single reads.
                      "XT:A:U" indicates the read uniquely mapped to the reference, why i still got XA for alternative alignment inforamtion?
                      It is confused me. Someone could help me a bit for that? Thank you very much

                      Comment

                      • lh3
                        Senior Member
                        • Feb 2008
                        • 686

                        #206
                        This read is mapped to the junction between two adjacent reference, so it gets an "unmapped" flag.

                        Comment

                        • NSTbioinformatics
                          Member
                          • Apr 2009
                          • 24

                          #207
                          I think, "4" is the "unmapped" flag, is it right?

                          What is difference between flag 4 and 20?

                          Thank you very much.

                          Comment

                          • nilshomer
                            Nils Homer
                            • Nov 2008
                            • 1283

                            #208
                            Originally posted by NSTbioinformatics View Post
                            I think, "4" is the "unmapped" flag, is it right?

                            What is difference between flag 4 and 20?

                            Thank you very much.
                            Use the "-X" option in "samtools view", it will probably help your interpretation of the FLAG field.

                            Comment

                            • ylc
                              Junior Member
                              • Feb 2010
                              • 2

                              #209
                              pick chromosome before bam sort?

                              A newbie question:
                              I can view by chromosome after a .bam file is sorted and indexed. Is it possible to extract by a chromosome number from the bam file and then do sorting and indexing? It will save time if I'm only interested in certain chromosomes and have many samples.

                              Thanks.

                              Comment

                              • seq_GA
                                Senior Member
                                • Feb 2009
                                • 124

                                #210
                                Hi,

                                I have few queries about samtools.

                                1. I am using eland mapping output and start using export2sam.pl. All the PF reads from export are being used for down stream analysis.
                                2. How the uniquely mapped and multiple mapped are hadled during pileup command?
                                3. The extended CIGAR column always shows 35M (ie the length of the read). How did the mismatch information would be incorporated? The column 15 of export contains the match descriptor information.

                                Thanks.
                                Last edited by seq_GA; 02-28-2010, 08:57 PM.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  New Genomics Technologies Take Aim at Long-Standing Limits
                                  by SEQadmin2


                                  Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                                  We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                                  ...
                                  Today, 10:25 AM
                                • SEQadmin2
                                  How Immunogenomics Decodes Immunity’s Genetic Blueprint
                                  by SEQadmin2




                                  The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                                  This convergence of genetics, immunology, and computation...
                                  09-01-2026, 05:41 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 09-25-2026, 09:06 AM
                                0 responses
                                28 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-23-2026, 11:05 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-18-2026, 11:37 AM
                                1 response
                                46 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Started by SEQadmin2, 09-16-2026, 10:23 AM
                                1 response
                                55 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Working...