Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • how to extract unique hits from a sam file

    I aligned reads with bwa and I want to get a set of the reads that mapped uniquely to the genome.
    I understood from samtools faq that they suggest to look at 'reliable' rather than `unique' by :

    samtools view -bq 1 aln.bam > aln-reliable.bam

    Download SAM tools for free. SAM (Sequence Alignment/Map) is a flexible generic format for storing nucleotide sequence alignment. SAMtools provide efficient utilities on manipulating alignments in the SAM format.


    However, I am interested to get the subset of the uniquely mapped reads, in order to do some calculations on it.

    How can one do it?

  • #2
    Take a look to this thread.

    I'd suggest you follow bwa's FAQ advice and rely more in the MAPQ. Still, if you want to
    filter uniquely mapped:

    Code:
    $ samtools view bwa.bam | grep "XT:A:U"
    -drd

    Comment


    • #3
      Thanks a lot!

      Comment


      • #4
        Hi,
        I am also looking for such solution. But in my bam file, I don't see any
        Code:
        XT:A:U
        instead its a SOLEXA single read where I have converted export to sam format as below.



        Code:
        test_1:8:69:19633:9434       0       chr10   5423197 4       45M     *       0       0       CACACAACCCCCACACCAAACACACACCCCCCACACACAACAAAC      0.2B90+)*=@8@################################   XD:Z:6C11C15G4CACT2     SM:i:4
        test_1:8:56:11474:20981      0       chr10   7323903 6       45M     *       0       0       ATCAAGCGATCCTCCCACCTCATCCCCCTAAGTACCTGTGACTAA      757@54;3;1@@@@@22@###########################   XD:Z:22G11G3G5C SM:i:6
        Any generic way of picking unique hits from sam file? Thanks.

        Comment


        • #5
          I am not an expert, but don't think you can extract this from the _export file. I think XT:A:U is specific to bwa (maybe also other aligners?).

          Maybe you would like to use the _sorted file from the Illumina pipeline:
          the desciption of the _sorted file- from CASAVA 1.7 manual p. 73:
          This output file is similar to s_N_export.txt, except it contains
          only entries for reads which pass purity filtering and have a
          unique alignment in the reference. These are sorted by order
          of their alignment position, which is meant to facilitate the
          extraction of ranges of reads for purposes of visualization or
          SNP calling.
          These files are only produced if the flag WITH_SORTED is
          used."

          Alternatively, you can take your reads and align them with bwa (or with other aligner that gives you this info).

          Comment


          • #6
            hello all,
            I have Illumina data, which I mapped through Bowtie2 and got a sam file.

            Now I need to extract the reads which are being shown uniquely one time.

            Kindly guide if something could be done for that.

            I have tried a bit of commands for the above, but failed to get those reads separated.

            Kindly guide ASAP.

            Comment


            • #7
              Originally posted by emp View Post
              hello all,
              I have Illumina data, which I mapped through Bowtie2 and got a sam file.

              Now I need to extract the reads which are being shown uniquely one time.

              Kindly guide if something could be done for that.

              I have tried a bit of commands for the above, but failed to get those reads separated.

              Kindly guide ASAP.
              How about just use bowtie with the -m 1 option set?

              Comment


              • #8
                hello Wallysb01,

                after searching a lot for Bowtie2 to get uniquely matched reads, I think bowtie 1 is the only way out.

                thanku for the same.

                Comment


                • #9
                  Unique alignments in bowtie2 have MAPQ>=2, so you can just filter the results by that.

                  Comment

                  Latest Articles

                  Collapse

                  • seqadmin
                    Exploring the Dynamics of the Tumor Microenvironment
                    by seqadmin




                    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
                    07-08-2024, 03:19 PM
                  • seqadmin
                    Exploring Human Diversity Through Large-Scale Omics
                    by seqadmin


                    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
                    06-25-2024, 06:43 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by seqadmin, 07-16-2024, 05:49 AM
                  0 responses
                  24 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 07-15-2024, 06:53 AM
                  0 responses
                  31 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 07-10-2024, 07:30 AM
                  0 responses
                  40 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 07-03-2024, 09:45 AM
                  0 responses
                  205 views
                  0 likes
                  Last Post seqadmin  
                  Working...
                  X