Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Extract Seq from Primers on BBDuK

    Hello guys, a newbie in here.

    I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap.

    First I tried this

    Code:
    ./bbduk.sh in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
    which gave me an error saying "Error: Could not find or load main class jgi.BBDukF"

    Then I searched and tried this running this code

    Code:
    java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
    then it gave me an error that read "Could not find or load main class in=first0.fastq"

    Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change.

    Thanks in advance.

  • #2
    Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

    Comment


    • #3
      Originally posted by GenoMax View Post
      Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?
      Nope, I am on biolinux(Ubuntu), and no I ve just extracted the zip file, didn't move anything. Thanks for a quick respond.

      Comment


      • #4
        Guys anyone can help me? I am still struggling with this.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Exploring the Dynamics of the Tumor Microenvironment
          by seqadmin




          The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
          07-08-2024, 03:19 PM
        • seqadmin
          Exploring Human Diversity Through Large-Scale Omics
          by seqadmin


          In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
          06-25-2024, 06:43 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 07-10-2024, 07:30 AM
        0 responses
        25 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-03-2024, 09:45 AM
        0 responses
        201 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-03-2024, 08:54 AM
        0 responses
        211 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-02-2024, 03:00 PM
        0 responses
        193 views
        0 likes
        Last Post seqadmin  
        Working...
        X