Extract Seq from Primers on BBDuK

[m.a.celik]

Hello guys, a newbie in here.

I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap.

First I tried this

./bbduk.sh in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA

which gave me an error saying "Error: Could not find or load main class jgi.BBDukF"

Then I searched and tried this running this code

java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA

then it gave me an error that read "Could not find or load main class in=first0.fastq"

Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change.

Thanks in advance.

[GenoMax]

Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

[m.a.celik]

Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

Nope, I am on biolinux(Ubuntu), and no I ve just extracted the zip file, didn't move anything. Thanks for a quick respond.

[m.a.celik]

Guys anyone can help me? I am still struggling with this.