Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • m.a.celik
    Junior Member
    • Jan 2019
    • 3

    #1

    Extract Seq from Primers on BBDuK

    Hello guys, a newbie in here.

    I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap.

    First I tried this

    Code:
    ./bbduk.sh in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
    which gave me an error saying "Error: Could not find or load main class jgi.BBDukF"

    Then I searched and tried this running this code

    Code:
    java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
    then it gave me an error that read "Could not find or load main class in=first0.fastq"

    Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change.

    Thanks in advance.
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

    Comment

    • m.a.celik
      Junior Member
      • Jan 2019
      • 3

      #3
      Originally posted by GenoMax View Post
      Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?
      Nope, I am on biolinux(Ubuntu), and no I ve just extracted the zip file, didn't move anything. Thanks for a quick respond.

      Comment

      • m.a.celik
        Junior Member
        • Jan 2019
        • 3

        #4
        Guys anyone can help me? I am still struggling with this.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 08-06-2026, 07:41 AM
        0 responses
        18 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-03-2026, 10:13 AM
        0 responses
        33 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-31-2026, 02:55 AM
        0 responses
        43 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-24-2026, 12:17 PM
        0 responses
        26 views
        0 reactions
        Last Post SEQadmin2  
        Working...