Would it be possible during the bcl demultiplexing specify the error/mismatch value for the index ?
Unconfigured Ad
Collapse
X
-
It seems that there are lots of things that has changed with v1.8. I wish Illumina releases at least a user guide/early version of the software. We can discuss all year long and still will not get the complete picture of the new version from the release notes alone. Many centers like ours have wrappers around these software for automation.
Comment
-
Hi,
V1.8 has some extra fields:
<is filtered> is Y if the read is filtered, N otherwise.
<control number> is 0 when none of the control bits are on, otherwise it is an even number.
Does anyone know what these are for?
Is is_filtered reminiscent of QSEQ quality flag and if so does 'Y' mean high or low quality?
Colin
Comment
-
@sparks -- this is just like the 0/1 (fail/pass) in the last field old qseq files. The problem, to my knowledge is that all reads are output to the fastq.qz. Y means failed QC. Seems backwards I know...
Illumina should have a flag in the configureBclToFastq.pl script to either a) exclude non-passing filter reads or b) write them into a different fastq.gz. Otherwise you have to unzip and do filtering this via your own scripting, and this is just a waste of time...
One other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
Comment
-
On a similar point, I'd already posted earlier on this thread that I thought removing the forward/reverse suffix (i.e. /1 or /2 at the end of the read name) and sticking this in the read description (after the space) was a bad idea.Originally posted by caddymob View PostOne other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
Comment
-
I missed that, but yes, very good point!Originally posted by maubp View PostOn a similar point, I'd already posted earlier on this thread that I thought removing the forward/reverse suffix (i.e. /1 or /2 at the end of the read name) and sticking this in the read description (after the space) was a bad idea.
Comment
-
Thanks for update, I'll ad a function in novoalign to filter the failed reads.Originally posted by caddymob View Post@sparks -- this is just like the 0/1 (fail/pass) in the last field old qseq files. The problem, to my knowledge is that all reads are output to the fastq.qz. Y means failed QC. Seems backwards I know...
Illumina should have a flag in the configureBclToFastq.pl script to either a) exclude non-passing filter reads or b) write them into a different fastq.gz. Otherwise you have to unzip and do filtering this via your own scripting, and this is just a waste of time...
One other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
With regard the barcode sequence it appears Illumina will have already demux'd the reads so all reads should have the same barcode. Is this correct or could we get a file with mixed index tags?
Colin
Comment
-
Couple test CASVA 1.8 fastqs with 400 reads for read 1 and read 2 attached, no QC filtering applied. Hope this helps!
Comment
-
Hi Caddymob,Originally posted by caddymob View PostCouple test CASVA 1.8 fastqs with 400 reads for read 1 and read 2 attached, no QC filtering applied. Hope this helps!
Thanks for that. The reads went perfectly though not many aligned against hg36, I guess they are not human.
Novoalign now recognises the 1.8 format and has options to skip, use or QC the is_filtered='Y' reads.
Cheers, Colin
Comment
-
FASTQ quality score above 40
With the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
Comment
-
See this: http://seqanswers.com/forums/showthread.php?t=12339Originally posted by SeqAnswerSeeker View PostWith the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
Comment
-
Hi Natalie,Originally posted by SeqAnswerSeeker View PostWith the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
there have been some improvements to the chemistry and a refinement of the quality model. As a result, we are now starting to see Q41. There is no additional meaning behind the "J".
Thanks,
Semyon
Comment
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 08-24-2026, 10:32 AM
|
0 responses
20 views
0 reactions
|
Last Post
by SEQadmin2
08-24-2026, 10:32 AM
|
||
|
Started by SEQadmin2, 08-20-2026, 11:17 AM
|
0 responses
37 views
0 reactions
|
Last Post
by SEQadmin2
08-20-2026, 11:17 AM
|
||
|
Started by SEQadmin2, 08-18-2026, 10:05 AM
|
0 responses
38 views
0 reactions
|
Last Post
by SEQadmin2
08-18-2026, 10:05 AM
|
||
|
Started by SEQadmin2, 08-13-2026, 12:22 PM
|
0 responses
48 views
0 reactions
|
Last Post
by SEQadmin2
08-13-2026, 12:22 PM
|
Comment